China Biotechnology

Figure/Table detail

Identification and Functional Characterization of the Geraniol Synthase Gene XmTPS from Xylaria multiplex

ZENG Jiatong, MENG Beilin, ZHOU Yuxin, ZENG Haichun

China Biotechnology, 2025, 45(12): 28-39. DOI: 10.13523/j.cb.202506018

基因	引物名称	引物序列 (5'→3')
XmTPS	pYEU-XmTPS-F	ACTATCAACTATTAACTATATCGTAATACCATATGCTTGCAAATC
XmTPS	pYEU-XmTPS-R	TAGTGATGGTGATGGTGATGCATATGATTGGCACTAGGGG

Table 1 Primer sequences used in this study

Other figure/table from this article

Fig.1 Construction of recombinant plasmid for expression of XmTPS gene in S. cerevisiae
Fig.2 Analysis of physicochemical properties of XmTPS A: Electrophoresis map of PCR product of XmTPS gene B: Prediction of transmembrane regions of XmTPS protein
Fig.3 Analysis of phylogenetic tree and conserved domain of XmTPS protein A: Phylogenetic tree analysis of XmTPS and selected fungal terpene synthases. Mono-TPSs: Monoterpene synthases; Sequi-TPSs: Sesquiterpene synthases; Di-TPSs: Diterpene synthases B: Analysis of conserved domain of XmTPS with characterized fungal monoterpene synthases XDJ26823.1,WPN08560.1 and QDO73502.1 are come from Penicillium griseofulvum; WPN08561.1 is from Penicillium italicum; WZN32273.1 is from Beauveria sp.; WZN32272.1 is from Nigrospora sp.; A0A348B793.1 is from Postia placenta; XP001832573.2, XP001836556.1 and XP001836356.1 are all from Coprinus cinereus; AGR34199.1 is from Armillaria gallica; AAQ16575.1 is from Botrytis cinerea; KLO85867.1 is from Fusarium fujikuroi; QJD26116.1 is from Myrothecium gramineum; A2PZA5.1 is from Diaporthe amygdali; QVR97762.1 is from Aspergillus flavipes; KAH8707297.1 is from Beauveria bassiana; P9WEV7.1 is from Colletotrichum gloeosporioides; B6HFX8.1 is from Penicillium rubens Wisconsin 54-1255; WKM69310.1 is from Candolleomyces candolleanus; AHY23922.1 is from Hypoxylon sp.
Fig.4 Sequence similarity network analysis of XmTPS protein The red branch represents XmTPS and its homologous proteins. AtTPS03, LcTPS2, PaTPS-Pin, PhTps-5042L and GmNES are plant monoterpene synthases (marked in green font). bLinS and CnsA are bacterial monoterpene synthases (marked in blue font). PgfTPS, PgfB, PpSTS25, Ni15096-TDTS, Ap.LS and Hyp3 are fungal monoterpene synthases (marked in black font)
Fig.5 SDS-PAGE analysis of purified XmTPS protein and GC-MS detection of its in vitro enzymatic reaction products A: SDS-PAGE analysis of purified XmTPS protein B: GC-MS analysis of nerol and geraniol standards, as well as products catalyzed by XmTPS with GPP in vitro reaction C: Mass spectra of the enzymatic reaction product (1) and the reference substance nerol and geraniol
Fig.6 The substrate promiscuity assay of XmTPS protein A: GC-MS analysis of products from XmTPS-catalyzed in vitro reactions with FPP and GGPP respectively B: Mass spectra of the enzymatic reaction product (2) catalyzed by XmTPS with FPP
Fig.7 Three-dimensional structure prediction and active site analysis of XmTPS protein A: Three-dimensional structure of XmTPS protein and its docking model with GPP B: Ramachandran plot analysis of the XmTPS protein model C: Prediction of active sites in XmTPS
Fig.8 Comparison of amino acid sequences and protein structures between XmTPS and PgfTPS A: Amino acid sequence alignment of XmTPS and PgfTPS. Conserved metal ion-binding motifs are marked with boxes B: Protein structure alignment of XmTPS and PgfTPS C: Active site alignment of XmTPS and PgfTPS. Conserved amino acid residues shared between the two proteins are marked with red boxes; other amino acids represent conserved metal ion-binding motifs

模态框（Modal）标题

Figure/Table detail