Please wait a minute...

中国生物工程杂志

China Biotechnology
China Biotechnology  2019, Vol. 39 Issue (3): 1-6    DOI: 10.13523/j.cb.20190301
    
The Inhibition of IFN Induce SAMHD1 to the Replication of HBV in Huh7.0 Cells
Miao QIAO,Jie HU,Bin-li MAO,Si-die PI,Yuan HU
Key Laboratory of Molecular Biology on Infectious Disease, Ministry of Education,Chongqing Medical University, Chongqing 400016, China
Download: HTML   PDF(927KB) HTML
Export: BibTeX | EndNote (RIS)      

Abstract  

Objective: To analyze the mechanism of the inhibition of IFNs induce SAMHD1 to hepatitis B virus(HBV)in liver cancer cells Huh7.0. Methods: (1) Recombiant expression plasmids of SAMHD1 (sterile alpha motif and histidine/ aspartic acid domain-containing protein 1) mutants that were defective in dNTPase (deoxynucleoside triphosphate triphosphohydrolase) activity and its nuclear location mutation were constructed. (2) The mRNA and protein levels of SAMHD1 in Huh7.0 cells by IFNs treatment were measured by real time and Western blot. (3) HBV core-associated DNA levels in transfected Huh7.0 cells were measured by Southern blot. (4) The location of SAMHD1 and its nuclear mutation in the Huh7.0 cells was measured by immunofluorescence. Results: (1) Both the RNA and protein levels of SAMHD1 were upregulated by interferons. (2) The antiviral function of SAMHD1 was lost when knocking down the expression of SAMHD1 by siRNA. (3) SAMHD1 lost its restriction towards HBV after mutating its NLS signal. Conclusion: IFNs can upregulate the expressing of SAMHD1 in Huh7 cells. SAMHD1 is mainly located in the nucleus and its restriction towards HBV dependent on its location.



Key wordsHepatitis B virus      Interferons      SAMHD1      Inhibition     
Received: 12 September 2018      Published: 12 April 2019
ZTFLH:  Q789  
Cite this article:

Miao QIAO,Jie HU,Bin-li MAO,Si-die PI,Yuan HU. The Inhibition of IFN Induce SAMHD1 to the Replication of HBV in Huh7.0 Cells. China Biotechnology, 2019, 39(3): 1-6.

URL:

https://manu60.magtech.com.cn/biotech/10.13523/j.cb.20190301     OR     https://manu60.magtech.com.cn/biotech/Y2019/V39/I3/1

引物 序列 (5'→3')
SAMHD1-D11-14 FP CGATTCCGAGCAGCCCTCCTGCGATGACA
SAMHD1-D11-14 RP TGTCATCGCAGGAGGGCTGCTCGGAATCG
SAMHD1-D207N FP GCTGGACTTTGTCATAATCTCGGTCATGGGCC
SAMHD1-D207N RP GGCCCATGACCGAGATTATGACAAAGTCCAGC
siSAMHD1FP: GCAGCCAACAGGACAAAUATT
siSAMHD1RP: UAUUUGUCCUGUUGGCUGCTT
Table 1 Sequence of primers for site-directed mutagenesis and siRNA target for SAMHD1
Fig.1 Interferon α、β、γ induce SAMHD1 expression in Huh7.0 cells
Fig.2 Effect of SAMHD1 knockdown on inhibition of IFN α、β toward HBV RC:Relaxed circular DNA;DL:Double-stranded linear DNA;SS:Single-stranded DNA
Fig.3 Distribution of SAMHD1 wide type and NLS deletion mutant
Fig.4 Inhibition of SAMHD1 and its NLS mutation on HBV RC DNA:Relaxed circular DNA;DL DNA:Double-stranded linear DNA;SS DNA:Single-stranded DNA
[1]   Schweitzer A, Horn J, Mikolajczyk R T , et al. Estimations of worldwide prevalence of chronic hepatitis B virus infection: A systematic review of data published between 1965 and 2013. Lancet, 2015,386(10003) : 1546-1555.
doi: 10.1016/S0140-6736(15)61412-X pmid: 1268839
[2]   Wei Y, Neuveut C, Tiollais P , et al. Molecular biology of the hepatitis B virus and role of the X gene. Pathologie Biologie, 2010,58(4):267-272.
doi: 10.1016/j.patbio.2010.03.005 pmid: 20483545
[3]   Bertoletti A, Ferrari C . Innate and adaptive immune responses in chronic hepatitis B virus infections: Towards restoration of immune control of viral infection. Gut, 2012,61(12):1754-1764.
doi: 10.1136/gutjnl-2011-301073
[4]   Chen Z, Zhang L, Ying S . SAMHD1: A novel antiviral factor in intrinsic immunity. Future Microbiology, 2012,7(9) : 1117-1126.
doi: 10.2217/fmb.12.81 pmid: 22953710
[5]   Laguette N, Sobhian B, Casartelli N , et al. SAMHD1 is the dendritic-and myeloid-cell-specific HIV-1 restriction factor counteracted by Vpx. Nature, 2011,474(7353):654-657.
doi: 10.1038/nature10117 pmid: 3595993
[6]   Hrecka K, Hao C, Gierszewska M , et al. Vpx relieves inhibition of HIV-1 infection of macrophages mediated by the SAMHD1 protein. Nature, 2011,474(7353) : 658-661.
doi: 10.1038/nature10195 pmid: 21720370
[7]   Lahouassa H, Daddacha W, Hofmann H , et al. SAMHD1 restricts the replication of human immunodeficiency virus type 1 by depleting the intracellular pool of deoxynucleoside triphosphates. Nature Immunology, 2012,13(3) : 223-228.
doi: 10.1038/ni.2236 pmid: 22327569
[8]   Kim E T, White T E, Brandariz-Núñez A , et al. SAMHD1 restricts herpes simplex virus 1 in macrophages by limiting DNA replication. Journal of Virology, 2013,87(23) : 12949-12956.
doi: 10.1128/JVI.02291-13 pmid: 3838123
[9]   Jeong G U, Park I H, Ahn K , et al. Inhibition of hepatitis B virus replication by a dNTPase-dependent function of the host restriction factor SAMHD1. Virology, 2016,495:71-78.
doi: 10.1016/j.virol.2016.05.001 pmid: 27179347
[10]   Goujon C, Schaller T, Galão R P , et al. Evidence for IFNα-induced, SAMHD1-independent inhibitors of early HIV-1 infection. Retrovirology, 2013,10:23.
doi: 10.1186/1742-4690-10-23 pmid: 23442224
[11]   Gelais C S, Silva S D, Amie S M , et al. SAMHD1 restricts HIV-1 infection in dendritic cells (DCs) by dNTP depletion, but its expression in DCs and primary CD4+ T-lymphocytes cannot be upregulated by interferons. Retrovirology , 2012,9:1-15.
doi: 10.1186/1742-4690-9-1 pmid: 3278356
[12]   Berger A, Sommer A F, Zwarg J , et al. SAMHD1-deficient CD14+ cells from individuals with Aicardi-Goutières syndrome are highly susceptible to HIV-1 infection. Plos Pathogens, 2011,7(12) : e1002425.
doi: 10.1371/journal.ppat.1002425 pmid: 3234228
[13]   Rio D C, Ares M, Hannon G J , et al. Purification of RNA using TRIzol (TRI Reagent) . Cold Spring Harbor Protocols, 2010, 2010(6) : pdb. prot5439.
doi: 10.1101/pdb.prot5439 pmid: 20516177
[14]   Bustin S A, Mueller R . Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis. Clinical Science, 2005,109(4) : 365-379.
doi: 10.1042/CS20050086 pmid: 16171460
[15]   Hu Y, Cheng X, Cao F , et al. Beta-Thujaplicinol inhibits hepatitis B virus replication by blocking the viral ribonuclease H activity. Antiviral Research, 2013,99(3) : 221-229.
doi: 10.1016/j.antivira1.2013.06.007 pmid: 23796982
[16]   Rice G I, Bond J, Asipu A . Mutations involved in Aicardi-Goutieres syndrome implicate SAMHD1 as regulator of the innate immune response. Nature Genetics, 2009,41(7) : 829-U89.
doi: 10.1038/ng.373 pmid: 4154505
[17]   Brandariz-Nuñez A , Valle-Casuso J C, White T E , et al. Role of SAMHD1 nuclear localization in restriction of HIV-1 and SIVmac. Retrovirology, 2012,9:49.
doi: 10.1186/1742-4690-9-49 pmid: 22691373
[18]   White T E, Brandariznuñez A, Vallecasuso J C , et al. Contribution of SAM and HD domains to retroviral restriction mediated by human SAMHD1. Virology, 2013,436(1) : 81-90.
doi: 10.1016/j.virol.2012.10.029 pmid: 3767443
[19]   Gramberg T, Kahle T, Bloch N , et al. Restriction of diverse retroviruses by SAMHD1. Retrovirology, 2013,10:26.
doi: 10.1186/1742-4690-10-26 pmid: 23497255
[20]   Sze A, Belgnaoui S M, Olagnier D , et al. Host restriction factor SAMHD1 limits human T cell leukemia virus type 1 infection of monocytes via STING-mediated apoptosis. Cell Host & Microbe, 2013,14(4) : 422-434.
doi: 10.1016/j.chom.2013.09.009 pmid: 24139400
[21]   Cribier A, Descours B, Valadão A L , et al. Phosphorylation of SAMHD1 by cyclin A2/CDK1 regulates its restriction activity toward HIV-1. Cell Reports, 2013,3(4):1036-1043.
doi: 10.1016/j.celrep.2013.03.017 pmid: 23602554
[1] XUE Zhi-yong,DAI Hong-sheng,ZHANG Xian-yuan,SUN Yan-ying,HUANG Zhi-wei. Effects of Vitreoscilla Hemoglobin Gene on Growth and Intracellular Oxidation State of Saccharomyces cerevisiae[J]. China Biotechnology, 2021, 41(11): 32-39.
[2] HAN Xue-yi,LI Yi-fan,LU Yue-da,XIONG Guo-liang,YU Chang-yuan. Preparation of Porphyrin Metal-organic Framework with Autophagy Inhibitory Effect and Its Photodynamic Cancer Treatment[J]. China Biotechnology, 2021, 41(11): 48-54.
[3] Xiao-yong ZHANG,Qian-cheng LUO. Establishment and Clinical Application of LNA-PCR Assay Detecting Hepatitis B Virus Adefovir Dipivoxil Resistance[J]. China Biotechnology, 2018, 38(9): 48-54.
[4] Kai-ren TIAN,Er-shu XUE,Qian-qian SONG,Jian-jun QIAO,Yan-ni LI. The Research Progress of CRISPR-dCas9 in Transcriptional Regulation[J]. China Biotechnology, 2018, 38(7): 94-101.
[5] Xiu-yu ZHANG,Ding WANG,Yan-e DU,Rui WU,Liang DUAN. S100A9 is Involved in Hepatitis B Virus X-induced Proliferation and Migration of Human Hepatocellular Carcinoma Cell HepG2[J]. China Biotechnology, 2018, 38(10): 1-7.
[6] SUN Wen-jia, YAO Yu-feng, YANG Xu, HUANG Wei-wei, LIU Cun-bao, LONG Qiong, CHU Xiao-jie, MA Yan-bing. Presentation of HPV 16L1 Peptide-based HBcAg Virus-like Particle and Induction of Specific Antibody[J]. China Biotechnology, 2017, 37(3): 58-64.
[7] CHEN Qing, ZHU Hong-fei, GUO Xiao-yu. Progress on DNA Innate Immune Recognition Receptors[J]. China Biotechnology, 2016, 36(5): 112-117.
[8] WANG Xiao-yan, CHEN Na-zi, AI Jun, ZHAO Yang, WU Mei-yu, HUANG Jin-zhi, JIANG Chao, LI Xiao-kun. Expression and Purification of Biological-active Recombinant HBV Precore Protein-Mouse IgG Fc Based on Baculovirus Expression Vector System[J]. China Biotechnology, 2015, 35(4): 42-47.
[9] CHEN Yan-meng, HUANG Yao, HU Jie, HU Yuan. APOBEC3A Inhibited HBV Replication Dependent Its Deamination[J]. China Biotechnology, 2015, 35(12): 8-14.
[10] SU Lan, ZHANG Ping, WANGYANG Jun-qi, ZHONG Ru-gang. Progress on the Inhibition of Hepatitis B virus by siRNA Strategy[J]. China Biotechnology, 2014, 34(9): 102-107.
[11] ZHAO Jing, LV Hui, Jiayinaguli·ZHUMABAI, SUN Su-rong. Construction of the Eukaryotic Expression Vector of PhLTP Gene and Its Primary Antitumor Effects in vitro and in vivo[J]. China Biotechnology, 2014, 34(8): 7-13.
[12] LIU Wei-xia, CHEN Zhi. Study on the Inhibition of Hepatitis B Virus by Single-chain Fv Fragment[J]. China Biotechnology, 2011, 31(12): 104-108.
[13] MA Ming-zhang, HOU Chun-xiao, WANG Qian, ZHANG Chuan-liang, LIU Jian-xin, WENG Xiao-yan. Current Progress on Endoxylanase Inhibitors in Cereals[J]. China Biotechnology, 2011, 31(04): 129-133.
[14] DIAO Li, ZHANG Wen-Lou, HU Yuan, LIU Pan-Chen, LAI Guo-Qi, YANG Feng, HUANG Ai-Long. Development of a Reverse Dot Blot System for rapid detection of HBV Genotypes[J]. China Biotechnology, 2009, 29(12): 85-89.
[15] . Detection of Cellular Binding Protein of Hepatitis B virus PreS1 Domain on HepG2 Cell Membane[J]. China Biotechnology, 2009, 29(09): 0-0.