PDF(1757 KB)
Construction of YOD1 Knockout Mice on CRISPR/Cas9 Technology
Hong-miao DAI,Ye-sheng FU,Ling-qiang ZHANG
China Biotechnology ›› 2018, Vol. 38 ›› Issue (6) : 52-57.
PDF(1757 KB)
PDF(1757 KB)
Construction of YOD1 Knockout Mice on CRISPR/Cas9 Technology
({{custom_author.role_en}}), {{javascript:window.custom_author_en_index++;}}Objective: Construct YOD1 gene knockout mice based on CRISPR/Cas9 technology. Methods: Design and synthesize single-guide RNA (sgRNA) according to the YOD1 sequence in Genbank. Cas9 and sgRNA are transcribed to RNA in vitro, these RNA are then microinjected into zygotes of mice. The genotype is analyzed by PCR and sequencing. After YOD1 heterozygotes self-crossing and analysis of genotype of live offspring at weaning, wild type(WT)and knockout genotype(KO)littermates of YOD1 gene are verified. It is recorded that quantity and ratio of each genotype of live offspring of YOD1 heterozygotes self-crossing. And it is evaluated whether the ratio is in agreement with Mendel’s law of segregation. Protein lysates are made from main organs of the WT and KO littermates. And western blotting is used to assay the expression of YOD1 protein of these tissues. Meanwhile, size and weight of main organs and tissues of KO and WT mice are compared. Then analyze pathological phenotype of liver by H.E. staining. The glucose tolerance test (GTT) are carried out on the male mice of 6 months old. Results: According to PCR analysis and sequencing results, it is chose that mouse with deletion mutation and frameshift mutation in exon 2 of YOD1 gene to breed. After YOD1 heterozygotes self-crossing, WT and KO littermates are generated. According to statistics results, it is in agreement with Mendel’s law of segregation that the ratio of live offspring. Therefore, it is suggested that YOD1 KO mice birth normally without embryonic lethality. Western blotting results show that the expression of YOD1 in main organs is knocked-out significantly. Liver of YOD1 KO mouse is smaller in size than of WT littermate. There is no significant pathological phenotype in liver of YOD1 KO mice. YOD1 KO mice have general glycemic control in a GTT as compared to the control mice. Conclusions: YOD1 gene knockout mice are constructed successfully on CRISPR/Cas9 technology. And YOD1 KO mice birth and live normally without embryonic lethality. Compared to the control mice, livers of YOD1 KO mice are smaller in size and YOD1 KO mice have general glycemic control.
Table 1 sgRNA targeting sequences表1 |
| 名称 | 序列(5'-3') |
|---|---|
| sgRNA-1 | CGCAGGTGAAGCTTTTGGTC TGG |
| sgRNA-2 | TGGTGCTCCTAGTTATGTCA GGG |
Table 2 Primer sequences表2 引物合成序列 |
| 名称 | 序列(5'-3') |
|---|---|
| YOD1-sg-tF1 | CCAACAGCAGTTACTTGTTCCCA |
| YOD1-sg-tR1 | CTTCCCCAAAACGATCAATTCTG |
Table 3 Live offspring at weaning from HET× HET表3 HET× HET子代各基因型存活数量 |
| Genotype | Quantity | Ratio |
|---|---|---|
| WT | 25 | 20.33% |
| HET | 66 | 53.66% |
| KO | 32 | 26.02% |
| [1] |
Deubiquitinases (DUBs) have fundamental roles in the ubiquitin system through their ability to specifically deconjugate ubiquitin from targeted proteins. The human genome encodes at least 98 DUBs, which can be grouped into 6 families, reflecting the need for specificity in their function. The activity of these enzymes affects the turnover rate, activation, recycling and localization of multiple proteins, which in turn is essential for cell homeostasis, protein stability and a wide range of signaling pathways. Consistent with this, altered DUB function has been related to several diseases, including cancer. Thus, multiple DUBs have been classified as oncogenes or tumor suppressors because of their regulatory functions on the activity of other proteins involved in tumor development. Therefore, recent studies have focused on pharmacological intervention on DUB activity as a rationale to search for novel anticancer drugs. This strategy may benefit from our current knowledge of the physiological regulatory mechanisms of these enzymes and the fact that growth of several tumors depends on the normal activity of certain DUBs. Further understanding of these processes may provide answers to multiple remaining questions on DUB functions and lead to the development of DUB-targeting strategies to expand the repertoire of molecular therapies against cancer.
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [2] |
Sixteen ovarian tumor (OTU) family deubiquitinases (DUBs) exist in humans, and most members regulate cell-signaling cascades. Several OTU DUBs were reported to be ubiquitin (Ub) chain linkage specific, but comprehensive analyses are missing, and the underlying mechanisms of linkage specificity are unclear. Using Ub chains of all eight linkage types, we reveal that most human OTU enzymes are linkage specific, preferring one, two, or a defined subset of linkage types, including unstudied atypical Ub chains. Biochemical analysis and five crystal structures of OTU DUBs with or without Ub substrates reveal four mechanisms of linkage specificity. Additional Ub-binding domains, the ubiquitinated sequence in the substrate, and defined S1' and S2 Ub-binding sites on the OTU domain enable OTU DUBs to distinguish linkage types. We introduce Ub chain restriction analysis, in which OTU DUBs are used as restriction enzymes to reveal linkage type and the relative abundance of Ub chains on substrates.
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [3] |
The OLE pathway of yeast regulates the level of the ER-bound enzyme 9-fatty acid desaturase OLE1, thereby controlling membrane fluidity. A central component of this regulon is the transcription factor SPT23, a homolog of mammalian NF- B. SPT23 is synthesized as an inactive, ER membrane-anchored precursor that is activated by regulated ubiquitin/proteasome-dependent processing (RUP). We now show that SPT23 dimerizes prior to processing and that the processed molecule, p90, retains its ubiquitin modification and initially remains tethered to its unprocessed, membrane-bound SPT23 partner. Subsequently, p90 is liberated from its partner for nuclear targeting by the activity of the chaperone-like CDC48UFD1/NPL4 complex. Remarkably, this enzyme binds preferentially ubiquitinated substrates, suggesting that CDC48UFD1/NPL4 is qualified to selectively remove ubiquitin conjugates from protein complexes.
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [4] |
Protein degradation in eukaryotes usually requires multiubiquitylation and subsequent delivery of the tagged substrates to the proteasome. Recent studies suggest the involvement of the AAA ATPase CDC48, its cofactors, and other ubiquitin binding factors in protein degradation, but how these proteins work together is unclear. Here we show that these factors cooperate sequentially through protein-protein interactions and thereby escort ubiquitin-protein conjugates to the proteasome. Central to this pathway is the chaperone CDC48/p97, which coordinates substrate recruitment, E4-catalyzed multiubiquitin chain assembly, and proteasomal targeting. Concomitantly, CDC48 prevents the formation of excessive multiubiquitin chain sizes that are surplus to requirements for degradation. In yeast, this escort pathway guides a transcription factor from its activation in the cytosol to its final degradation and also mediates proteolysis at the endoplasmic reticulum by the ERAD pathway.
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [5] |
Ubiquitin-dependent protein degradation usually involves escort factors that target ubiquitylated substrates to the proteasome. A central element in a major escort pathway is Cdc48, a chaperone-like AAA ATPase that collects ubiquitylated substrates via alternative substrate-recruiting cofactors. Cdc48 also associates with Ufd2, an E4 multiubiquitylation enzyme that adds further ubiquitin moieties to preformed ubiquitin conjugates to promote degradation. Here, we show that E4 can be counteracted in vivo by two distinct mechanisms. First, Ufd3, a WD40 repeat protein, directly competes with Ufd2, because both factors utilize the same docking site on Cdc48. Second, Cdc48 also binds Otu1, a deubiquitylation enzyme, which disassembles multiubiquitin chains. Notably, Cdc48 can bind Otu1 and Ufd3 simultaneously, making a cooperation of both inhibitory mechanisms possible. We propose that the balance between the distinct substrate-processing cofactors may determine whether a substrate is multiubiquitylated and routed to the proteasome for degradation or deubiquitylated and/or released for other purposes.
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [6] |
YOD1 is a highly conserved deubiquitinating enzyme of the ovarian tumor (otubain) family, whose function has yet to be assigned in mammalian cells. YOD1 is a constituent of a multiprotein complex with p97 as its nucleus, suggesting a functional link to a pathway responsible for the dislocation of misfolded proteins from the endoplasmic reticulum. Expression of a YOD1 variant deprived of its deubiquitinating activity imposes a halt on the dislocation reaction, as judged by the stabilization of various dislocation substrates. Accordingly, we observe an increase in polyubiquitinated dislocation intermediates in association with p97 in the cytosol. This dominant-negative effect is dependent on the UBX and Zinc finger domains, appended to the N and C terminus of the catalytic otubain core domain, respectively. The assignment of a p97-associated ubiquitin processing function to YOD1 adds to our understanding of p97's role in the dislocation process.
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [7] |
Antigen presenting cells (APCs) that express a catalytically inactive version of the deubiquitylase YOD1 (YOD1-C160S) present exogenous antigens more efficiently to CD8(+) T cells, both in vitro and in vivo. Compared with controls, immunization of YOD1-C160S mice led to greater expansion of specific CD8(+) T cells and showed improved control of infection with a recombinant gamma-herpes virus, MHV-68, engineered to express SIINFEKL peptide, the ligand for the ovalbumin-specific TCR transgenic OT-I cells. Enhanced expansion of specific CD8(+) T cells was likewise observed on infection of YOD1-C160S mice with a recombinant influenza A virus expressing SIINFEKL. YOD1-C160S APCs retained antigen longer than did control APCs. Enhanced cross-presentation by YOD1-C160S APCs was transporter associated with antigen processing (TAP1)-independent but sensitive to inclusion of inhibitors of acidification and of the proteasome. The activity of deubiquitylating enzymes may thus help control antigen-specific CD8(+) T-cell responses during immunization. (Blood. 2013; 121(7): 1145-1156)
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [8] |
AbstractRupture of endosomes and lysosomes is a major cellular stress condition leading to cell death and degeneration. Here, we identified an essential role for the ubiquitin‐directed AAA‐ATPase, p97, in the clearance of damaged lysosomes by autophagy. Upon damage, p97 translocates to lysosomes and there cooperates with a distinct set of cofactors including UBXD1, PLAA, and the deubiquitinating enzyme YOD1, which we term ELDR components for Endo‐Lysosomal Damage Response. Together, they act downstream of K63‐linked ubiquitination and p62 recruitment, and selectively remove K48‐linked ubiquitin conjugates from a subpopulation of damaged lysosomes to promote autophagosome formation. Lysosomal clearance is also compromised in MEFs harboring a p97 mutation that causes inclusion body myopathy and neurodegeneration, and damaged lysosomes accumulate in affected patient tissue carrying the mutation. Moreover, we show that p97 helps clear late endosomes/lysosomes ruptured by endocytosed tau fibrils. Thus, our data reveal an important mechanism of how p97 maintains lysosomal homeostasis, and implicate the pathway as a modulator of degenerative diseases.
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [9] |
The ubiquitin ligase TRAF6 is a key regulator of canonical IκB kinase (IKK)/NF-κB signaling in response to interleukin-1 (IL-1) stimulation. Here, we identified the deubiquitinating enzyme YOD1 (OTUD2) as a novel interactor of TRAF6 in human cells. YOD1 binds to the C-terminal TRAF homology domain of TRAF6 that also serves as the interaction surface for the adaptor p62/Sequestosome-1, which is required for IL-1 signaling to NF-κB. We show that YOD1 competes with p62 for TRAF6 association and abolishes the sequestration of TRAF6 to cytosolic p62 aggregates by a non-catalytic mechanism. YOD1 associates with TRAF6 in unstimulated cells but is released upon IL-1β stimulation, thereby facilitating TRAF6 auto-ubiquitination as well as NEMO/IKKγ substrate ubiquitination. Further, IL-1 triggered IKK/NF-κB signaling and induction of target genes is decreased by YOD1 overexpression and augmented after YOD1 depletion. Hence, our data define that YOD1 antagonizes TRAF6/p62-dependent IL-1 signaling to NF-κB. DOI:http://dx.doi.org/10.7554/eLife.22416.001
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [10] |
Hippo signaling controls the expression of genes regulating cell proliferation and survival and organ size. The regulation of core components in the Hippo pathway by phosphorylation has been extensively investigated, but the roles of ubiquitination61deubiquitination processes are largely unknown. To identify deubiquitinase(s) that regulates Hippo signaling, we performed unbiased siRNA...
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [11] |
Ubiquitination, a fundamental post-translational modification of intracellular proteins, is enzymatically reversed by deubiquitinase enzymes (deubiquitinases). >90 deubiquitinases have been identified. One of these enzymes, YOD1, possesses deubiquitinase activity and is similar to ovarian tumor domain-containing protein 1, which is associated with regulation of the endoplasmic reticulum (ER)-associated degradation pathway. Indeed, YOD1 is reported to be involved in the ER stress response induced by mislocalization of unfolded proteins in mammalian cells. However, it has remained unclear whether YOD1 is associated with pathophysiological conditions such as mitochondrial damage, impaired proteostasis, and neurodegeneration. We demonstrated that YOD1 possesses deubiquitinating activity and exhibits preference for K48- and K63-linked ubiquitin. Furthermore, YOD1 expression levels increased as a result of various stress conditions. We demonstrated that the neurogenic proteins that cause Huntington disease and Parkinson's disease induced upregulation of YOD1 level. We observed that YOD1 reduced disease cytotoxicity through efficient degradation of mutant proteins, whereas this activity was abolished by catalytically inactive YOD1. Additionally, YOD1 localized to Lewy bodies in Parkinson's disease patients. Collectively, these data suggest that the deubiquitinase YOD1 contributes to pathogenesis of neurodegenerative disease by decreasing ubiquitination of abnormal proteins and their subsequent degradation.
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [12] |
Adipose tissue development and function play a central role in the pathogenesis and pathophysiology of metabolic syndromes. Here, we show that chicken ovalbumin upstream promoter transcription factor II (COUP-TFII) plays a pivotal role in adipogenesis and energy homeostasis. COUP-TFII is expressed in the early stages of white adipocyte development. COUP-TFII heterozygous mice (COUP-TFII+/61) have much less white adipose tissue (WAT) than wild-type mice (COUP-TFII+/+). COUP-TFII+/61 mice display a decreased expression of key regulators for WAT development. Knockdown COUP-TFII in 3T3-L1 cells resulted in an increased expression of Wnt10b, while chromatin immunoprecipitation analysis revealed that Wnt10b is a direct target of COUP-TFII. Moreover, COUP-TFII+/61 mice have increased mitochondrial biogenesis in WAT, and COUP-TFII+/61 mice have improved glucose homeostasis and increased energy expenditure. Thus, COUP-TFII regulates adipogenesis by regulating the key molecules in adipocyte development and can serve as a target for regulating energy metabolism.
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [13] |
Bacteria and Archaea have developed several defence strategies against foreign nucleic acids such as viral genomes and plasmids. Among them, clustered regularly interspaced short palindromic repeats (CRISPR) loci together with cas (CRISPR-associated) genes form the CRISPR/Cas immune system, which involves partially palindromic repeats separated by short stretches of DNA called spacers, acquired from extrachromosomal elements. It was recently demonstrated that these variable loci can incorporate spacers from infecting bacteriophages and then provide immunity against subsequent bacteriophage infections in a sequence-specific manner. Here we show that the Streptococcus thermophilus CRISPR1/Cas system can also naturally acquire spacers from a self-replicating plasmid containing an antibiotic-resistance gene, leading to plasmid loss. Acquired spacers that match antibiotic-resistance genes provide a novel means to naturally select bacteria that cannot uptake and disseminate such genes. We also provide in vivo evidence that the CRISPR1/Cas system specifically cleaves plasmid and bacteriophage double-stranded DNA within the proto-spacer, at specific sites. Our data show that the CRISPR/Cas immune system is remarkably adapted to cleave invading DNA rapidly and has the potential for exploitation to generate safer microbial strains.
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [14] |
Viral and nonviral delivery of sgRNAs in CRISPR-Cas9 knockin mice enables diverse genome engineering applications in biology and disease modeling.
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [15] |
Targeted nucleases are powerful tools for mediating genome alteration with high precision. The RNA-guided Cas9 nuclease from the microbial clustered regularly interspaced short palindromic repeats (CRISPR) adaptive immune system can be used to facilitate efficient genome engineering in eukaryotic cells by simply specifying a 20-nt targeting sequence within its guide RNA. Here we describe a set of tools for Cas9-mediated genome editing via nonhomologous end joining (NHEJ) or homology-directed repair (HDR) in mammalian cells, as well as generation of modified cell lines for downstream functional studies. To minimize off-target cleavage, we further describe a double-nicking strategy using the Cas9 nickase mutant with paired guide RNAs. This protocol provides experimentally derived guidelines for the selection of target sites, evaluation of cleavage efficiency and analysis of off-target activity. Beginning with target design, gene modifications can be achieved within as little as 1-2 weeks, and modified clonal cell lines can be derived within 2-3 weeks.
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [16] |
Abstract Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) protein 9 system provides a robust and multiplexable genome editing tool, enabling researchers to precisely manipulate specific genomic elements, and facilitating the elucidation of target gene function in biology and diseases. CRISPR/Cas9 comprises of a nonspecific Cas9 nuclease and a set of programmable sequence-specific CRISPR RNA (crRNA), which can guide Cas9 to cleave DNA and generate double-strand breaks at target sites. Subsequent cellular DNA repair process leads to desired insertions, deletions or substitutions at target sites. The specificity of CRISPR/Cas9-mediated DNA cleavage requires target sequences matching crRNA and a protospacer adjacent motif locating at downstream of target sequences. Here, we review the molecular mechanism, applications and challenges of CRISPR/Cas9-mediated genome editing and clinical therapeutic potential of CRISPR/Cas9 in future. The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| [17] |
Derived from a microbial defense system, Cas9 can be guided to specific locations within complex genomes by a short RNA. The development, applications, and future directions of the CRISPR-Cas9 system for genome engineering are discussed here.
{{custom_citation.content}}
{{custom_citation.annotation}}
|
| {{custom_ref.label}} |
{{custom_citation.content}}
{{custom_citation.annotation}}
|
The authors have declared that no competing interests exist.
作者已声明无竞争性利益关系。
PDF(1757 KB)
Fig.1 YOD1 knockout strategy
Table 1 sgRNA targeting sequencesTable 2 Primer sequencesFig.2 Genotype of YOD1 knockout miceTable 3 Live offspring at weaning from HET× HETFig.3 The expression of YOD1 in tissues of KO mice is knocked-out significantlyFig.4 Liver of YOD1 KO mouse is smaller in sizeFig.5 Glucose tolerance test(n=3)/
| 〈 |
|
〉 |
