Study on the Production of Indole-3-acetic Acid Using <i>E. coli</i> Cell Factory

doi:10.13523/j.cb.2008123

China Biotechnology

2021, Vol. 41

Issue (1): 12-19 DOI: 10.13523/j.cb.2008123

Study on the Production of Indole-3-acetic Acid Using E. coli Cell Factory

WU Hong-xuan¹,YANG Jin-hua¹,SHEN Pei-jie¹,LI Qing-chen¹,HUANG Jian-zhong¹,QI Feng^1,^2,^**(

)

1 School of Life Science, National and Local Joint Engineering Research Center of Industrial Microbial Fermentation Technology,Fujian Normal University, Fuzhou 350117, China
2 Provincial University Key Laboratory of Cellular Stress Response and Metabolic Regulation,College of Life Sciences, Fujian Normal University, Fuzhou 350108, China

Download:

HTML

PDF(16123KB) HTML
Export: BibTeX | EndNote (RIS)

Abstract

Objective: Indole-3-acetic acid (IAA) was produced from tryptophan in the metabolically engineered E. coli MG1655 using whole-cell catalysis. Methods: Two novel IAA biosynthetic pathways, the indole-3-acetamide (IAM) pathway and the tryptamine (TRP) pathway, were constructed in E. coli MG1655. Results: The IAM pathway involves two enzymes, tryptophan-2- monooxygenase (IAAM) and amidase (AMI1). 2g/L tryptophan as a substrate was used by the constructed recombinant E. coli strain TPA-4. TPA-4 can produce 0.803g/L of IAA; however, in the strain MPA-3 that was knocked out the gene tnaA which divert flux from tryptophan synthesis, the yield of IAA reached 1.43g/L, an increase of 78% compared with the control. The second TRP pathway biosynthesis of IAA involves three enzymes: L-tryptophan decarboxylase (TDC), diamine oxidase (AOC1) and indole-3-acetaldehyde dehydrogenase (IAD1). The recombinant E.coli TPTA-2 that included the TRP pathway can only synthesize 13.0mg/L IAA with 2g/L tryptophan as substrate. In the strain MPTA-3 with disruption of tnaA gene, 21.0mg/L of IAA was finally produced, and the yield increased by 61.5%. Conclusion: It is the first report to realize production of IAA using the metabolically engineered E. coli through the IAM pathway and TRP pathway via whole-cell catalysis. IAA production from the IAM pathway is relatively higher, and it probably has an industrial application prospect.

Key words： Tryptophan Indole-3-acetic acid Indole-3-acetamide Tryptamine Whole cell catalysis E. coli

Received: 14 August 2020 Published: 09 February 2021

ZTFLH:

Q819

Corresponding Authors: Feng QI E-mail: f.qi@fjnu.edu.cn

	Service
	E-mail this article
	Add to my bookshelf
	Add to citation manager
	E-mail Alert
	RSS
	Articles by authors
	WU Hong-xuan
	YANG Jin-hua
	SHEN Pei-jie
	LI Qing-chen
	HUANG Jian-zhong
	QI Feng

Cite this article:

WU Hong-xuan, YANG Jin-hua, SHEN Pei-jie, LI Qing-chen, HUANG Jian-zhong, QI Feng. Study on the Production of Indole-3-acetic Acid Using E. coli Cell Factory. China Biotechnology, 2021, 41(1): 12-19.

URL:

https://manu60.magtech.com.cn/biotech/10.13523/j.cb.2008123 OR https://manu60.magtech.com.cn/biotech/Y2021/V41/I1/12

Fig.1 Biosynthetic pathways of indole-3-acetic acid

Table 1 Strains and plasmids used in the study

Primers	Sequence(5'-3')
iaaM-F	ggaaacagaccatggaattcaaggagatgtacgatcatttcaaca
iaaM-R	gatccccgggtaccgagctcttaataacgataacttgcat
V-iaaM-F	atgcaagttatcgttattaagagctcggtacccgg
V-iaaM-R	aaatgatcgtacatctccttgaattccatggtctgtttcctgt
amiE-F	aaggatcctctagagtcgacaaggagatgcgtcacggcgatatttc
amiE-R	ccgccaaaacagccaagcttttatcaggcctccttctccagtc
V-amiE-F	tggagaaggaggcctgataaaagcttggctgttttggcgg
V-amiE-R	gaaatatcgccgtgacgcatctccttgtcgactctagaggatcctt
ami1-F	aaggatcctctagagtcgacaaggagatggcaaccaataatgattt
ami1-R	ccgccaaaacagccaagcttttaaatgaatgctgccaga
V-ami1-F	gtctggcagcattcatttaaaagcttggctgttttggc
V-ami1-R	ttattggttgccatctccttgtcgactctagaggatcctt
tac-amiE-F	aaggatcctctagagtcgaccacagctaacaccacgtcgt
tac-amiE-R	tcgccgtgacgcatctccttggttaattcctcctgttacg
V-tac-amiE-F	cgtaacaggaggaattaaccaaggagatgcgtcacggcga
V-tac-amiE-R	acgacgtggtgttagctgtggtcgactctagaggatcctt
tac-ami1-F	aaggatcctctagagtcgaccacagctaacaccacgt
tac-ami1-R	ttattggttgccatctccttggttaattcctcctgttacg
V-tac-ami1-F	cgtaacaggaggaattaaccaaggagatggcaaccaataa
V-tac-ami1-R	acgacgtggtgttagctgtggtcgactctagaggatcctt
tdC-F	gatccgaagcagcggcaaaaaggaggatggatatcgaagcatttcg
tdC-R	ttgcatgcctgcaggtcgacttactgcacgtctttactaa
V-tdC-F	ttagtaaagacgtgcagtaagtcgacctgcaggcatgcaa
V-tdC-R	gcttcgatatccatcctcctttttgccgctgcttcggatc
aoc1-F	acctgcaggcatgcaagcttaaggagatgctgccgcatccg
aoc1-R	tctcatccgccaaaacagccttaaatatgggcattacgac
V-aoc1-F	gtcgtaatgcccatatttaaggctgttttggcggatgaga
V-aoc1-R	ggatgcggcagcatctccttaagcttgcatgcctgcaggt
iad1-F	ccatatttaaggctgttttgaaggagatgccgaccctgaatctg
iad1-R	gaaaatcttctctcatccgcttaaatcggtgccggct
V-iad1-F	gccagccggcaccgatttaagcggatgagagaagatttt
V-iad1-R	ttcagggtcggcatctccttcaaaacagccttaaatatgg
tac-aoc1-F	acctgcaggcatgcaagcttcacagctaacaccacgt
tac-aoc1-R	ggatgcggcagcatctccttggttaattcctcctgttacg
V- tac-aoc1-F	cgtaacaggaggaattaaccaaggagatgctgccgcatcc
V- tac-aoc1-R	acgacgtggtgttagctgtgaagcttgcatgcctgcaggt
tac-iad1-F	ccatatttaaggctgttttgcacagctaacaccacgtcgt
tac-iad1-R	ttcagggtcggcatctccttggttaattcctcctgttacg
V- tac-iad1-F	cgtaacaggaggaattaaccaaggagatgccgaccctgaa
V- tac-iad1-R	acgacgtggtgttagctgtgcaaaacagccttaaatatgg
tdc-F	gatccgaagcagcggcaaaaaggaggatgggcagcattgatagtac
tdc-R	ttgcatgcctgcaggtcgacttatgcttctttcagcagat
V- tdc-F	atctgctgaaagaagcataagtcgacctgcaggcatgcaa
V- tdc-R	tcaatgctgcccatcctcctttttgccgctgcttcggatc
Y-F	ataatgttttttgcgccgac
Y-R	atctgtatcaggctgaaaat

Table 2 Primers used in the study

Fig.2 Biosynthesis of IAA via indole-3-acetamide pathway (a) Schematic presentation of the indole-3-acetamide pathway constructed in the recombinant strain E. coli MG1655 to synthesize IAA (b)The consumption of tryptophan and production of IAM and IAA in the strain MPA-1 (c) The consumption of tryptophan and production of IAM and IAA in the strain MPA-2 (d) The consumption of tryptophan and production of IAM and IAA in the strain MPA-3

Fig.3 Biosynthesis of IAA via tryptamine pathway (a) (b) Schematic presentation of the tryptamine pathway constructed in the recombinant strain E. coli MG1655 to synthesize IAA (c) The production of IAA in the TPTA-2, MPTA-2 and MPTA-3 strains


[1]	Wagi S, Ahmed A. Bacillus spp.: potent microfactories of bacterial IAA. PeerJ, 2019,7:e7258.

[2]	Zhao Y D. Auxin biosynthesis and its role in plant development. Annual Review of Plant Biology, 2010,61(1):49-64.

[3]	Spaepen S, Vanderleyden J, Remans R. Indole-3-acetic acid in microbial and microorganism-plant signaling. FEMS Microbiology Reviews, 2007,31(4):425-448. doi: 10.1111/j.1574-6976.2007.00072.x pmid: 17509086

[4]	Hoffman M T, Gunatilaka M K, Wijeratne K, et al. Endohyphal bacterium enhances production of indole-3-acetic acid by a foliar fungal endophyte. PLoS One, 2013,8(9):e73132. pmid: 24086270

[5]	Kang B R, Yang K Y, et al. Production of indole-3-acetic acid in the plant-beneficial strain Pseudomonas chlororaphis O6 is negatively regulated by the global sensor kinase GacS. Current Microbiology, 2006,52(6):473-476. doi: 10.1007/s00284-005-0427-x pmid: 16732458

[6]	Malhotra M, Srivastava S. Targeted engineering of Azospirillum brasilense SM with indole acetamide pathway for indoleacetic acid over-expression. Canadian Journal of Microbiology, 2006,52(11):1078-1084. pmid: 17215899

[7]	Shokri D, Emtiazi G. Indole-3-acetic acid (IAA) production in symbiotic and non-symbiotic nitrogen-fixing bacteria and its optimization by taguchi design. Current Microbiology, 2010,61(3):217-225.

[8]	Hao X L, Xie P. Genome sequence and mutational analysis of plant-growthpromoting bacterium Agrobacterium tumefaciens CCNWGS0286 isolated from a zinc-lead mine tailing. Applied and Environmental Microbiology, 2012,78(15):5384-5394.

[9]	Ghosh P K, Sen S K, Maiti T K. Production and metabolism of IAA by Enterobacter spp. (Gammaproteobacteria) isolated from root nodules of a legume Abrus precatorius L. Biocatalysis and Agricultural Biotechnology, 2015,4(3):296-303. doi: 10.1016/j.bcab.2015.04.002

[10]	Fedorov D N, Doronina N V, Trotsenko Y A. Cloning and characterization of indolepyruvate decarboxylase from Methylobacterium extorquens AM1. Biochemistry, 2010,75(12):1435-1443.

[11]	Guo D Y, Kong S J, Chu X, et al. De novo biosynthesis of indole-3-acetic acid in engineered Escherichia coli. Journal of Agricultural and Food Chemistry, 2019,67(29):8186-8190.

[12]	Sekine M, Watanabe K, Syono K. Molecular cloning of a gene for indole-3-acetamide hydrolase from Bradyrhizobium japonicum. Journal of Bacteriology, 1989,171(3):1718-1724.

[13]	Chakraborty D, Gupta G, Kaur B. Metabolic engineering of E.coli top 10 for production of vanillin through FA catabolic pathway and bioprocess optimization using RSM. Protein Expression and Purification, 2016,128:123-133.

[14]	Tsavkelova E, Oeser B, Oren-Young L, et al. Identification and functional characterization of indole-3-acetamide-mediated IAA biosynthesis in plant-associated Fusarium species. Fungal Genetics & Biology, 2012,49(1):48-57.

[15]	Andrade J, Karmali A, Carrondoa M A, et al. Crystallization, diffraction data collection and preliminary crystallographic analysis of hexagonal crystals of Pseudomonas aeruginosa amidase. Acta Crystallographica, 2007,F63:214-216.

[16]	Neu D, Lehmann T, Elleuche S, et al. Arabidopsis amidase 1, a member of the amidase signature family. The FEBS Journal, 2007,274(13):3440-3451.

[17]	Zhu Y L, Hua Y, Zhang B, et al. Metabolic engineering of indole pyruvic acid biosynthesis in Escherichia coli with tdiD. Microbial Cell Factories, 2017, DOI: 10.1186/s12934-016-0620-6. pmid: 33468164

[18]	Basse C W, Lottspeich F, Steglich W, et al. Two potential indole-3-acetaldehyde dehydrogenases in the phytopathogenic fungus Ustilago maydis. European Journal of Biochemistry, 1996,242(3):648-656.

[19]	Kalb D, Gressler J, Hoffmeister D, et al. Active-site engineering expands the substrate profile of the Basidiomycete L-tryptophan decarboxylase CsTDC. Chembiochem, 2016,17(2):132-136.

[20]	W N, Mollenschott C, Berlin J.Tryptophan decarboxylase from Catharanthus roseus cell suspension cultures: purification, molecular and kinetic data of the homogenous protein. Plant Molecular Biology, 1984,3:281-288.

[21]	Romasi E F, Lee J H. Development of indole-3-acetic acid-producing Escherichia coli by functional expression of IpdC, AspC, and Iad1. Journal of Microbiology and Biotechnology, 2013,23(12):1726-1736.

[22]	Markus B, Christoph K, Patrick M, et al. Enhanced production of indole-3-acetic acid by a genetically modified strain of Pseudomonas fluorescens CHA0 affects root growth of cucumber, but does not improve protection of the plant against Pythium root rot. FEMS Microbiology Ecology, 1999,28(3):225-233.

[1]	YAN Wei-huan,HUANG Tong,HONG Jie-fang,MA Yuan-yuan. Recent Advances in Butanol Biosynthesis of Escherichia coli[J]. China Biotechnology, 2020, 40(9): 69-76.

[2]	Cheng-cheng ZHAO,Chang-po SUN,Xiao-jiao CHANG,Song-ling WU,Zhen-quan LIN. Construction and Application of Cell Lysis Systems in the Expression of Mycotoxin Degrading Enzyme in Escherichia coli[J]. China Biotechnology, 2019, 39(4): 69-77.

[3]	CHEN Sheng, LI Yan, LIU Huan, YAN Ming, XU Lin. Research Advances in Biosynthesis of UDPG[J]. China Biotechnology, 2012, 32(09): 125-130.

[4]	ZHAO Zhi-jun, CHEN Sheng, WU Dan, WU Jing, CHEN Jian. Metabolic Engineering of L-tryptophan via Microbiological Fermentation[J]. China Biotechnology, 2011, 31(06): 135-141.

[5]	HUANG Jing, SHI Jian-ming, HUO Wen-ting, XU Qing-yang, XIE Xi-xian, WEN Ting-yi, CHEN Ning. The Effects of NH₄⁺ on L-tryptophan Fermentation[J]. China Biotechnology, 2011, 31(03): 55-60.

Viewed

Full text

Abstract

Cited

Shared

Discussed