Probing the Role of N-glycosylation on the Catalytic Domain in the Activity and Secretion of Fungal Cellobiohydrolase

doi:10.13523/j.cb.2101002

China Biotechnology

2021, Vol. 41

Issue (4): 18-29 DOI: 10.13523/j.cb.2101002

Probing the Role of N-glycosylation on the Catalytic Domain in the Activity and Secretion of Fungal Cellobiohydrolase

LIN Yan-mei,LUO Xiang,LI Rui-jie,QIN Xiu-lin(

),FENG Jia-xun

College of Life Science and Technology, State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, Guangxi Research Center for Microbial and Enzyme Engineering Technology, Guangxi University, Nanning 530004, China

Download:

HTML

PDF(23354KB) HTML
Export: BibTeX | EndNote (RIS)

Abstract

Objective: Cellulases are responsible for the turnover of plant cell wall polysaccharides in the biosphere, and thus form the foundation of enzyme engineering efforts in biofuels research and industrial processes. Many of these carbohydrate-active enzymes from filamentous fungi contain both N-glycans and O-glycans, which in turn can unpredictably affect activity and secretion. Understanding the roles of glycosylation in the function of cellulase is important for further improvement of the enzyme technology for biomass conversion. Methods: The N-glycans defective mutants PoCel7A^* and TaCel7A^*, removal of the N-glycans on the catalytic domain of cellobiohydrolases from Penicillium oxalicum (PoCel7A) and Trichoderma atroviride (TaCel7A), were constructed using site directed mutagenesis. The extracellular protein concentration and enzymatic activity of the recombinant strains, expressing of PoCel7A ^*, TaCel7A or TaCel7A^*, were determined to investigate whether the removal of N-glycosylation affects the activity and secretion of cellobiohydrolases. Results: The mutant PoCel7A^* homologous expression in P. oxalicum, the removal of Asn137 glycosylation site at PoCel7A hardly affected the activity and secretion of Cel7A. However, after the Asn287 glycosylation site of TaCel7A was removed (TaCel7A ^*) and heterologous expression in P. oxalicum, the pNPCase, FPase and Avicelase activity of mutant decreased by 21.2%, 15.2% and 17.6%, respectively. Furthermore, compared to the parental strain, the expression levels of the UPR marker genes pdi1, bip1 and hac1 were significantly induced in recombinant strains, indicating increased demand for protein folding and transport capacity in recombinant strains. Conclusion: These results indicate that differential roles of N-glycan modifications in contributing to the function of Cel7A and highlight the potential of improving the activity and secretion of Cel7A by tuning proper interactions between glycans and functional residues.

Key words： Cellulase Cellobiohydrolase N-glycosylation Filamentous fungi

Received: 31 December 2020 Published: 30 April 2021

ZTFLH:

Q819

Corresponding Authors: Xiu-lin QIN E-mail: xiulinqin@gxu.edu.cn

	Service
	E-mail this article
	Add to my bookshelf
	Add to citation manager
	E-mail Alert
	RSS
	Articles by authors
	Yan-mei LIN
	Xiang LUO
	Rui-jie LI
	Xiu-lin QIN
	Jia-xun FENG

Cite this article:

LIN Yan-mei,LUO Xiang,LI Rui-jie,QIN Xiu-lin,FENG Jia-xun. Probing the Role of N-glycosylation on the Catalytic Domain in the Activity and Secretion of Fungal Cellobiohydrolase. China Biotechnology, 2021, 41(4): 18-29.

URL:

https://manu60.magtech.com.cn/biotech/10.13523/j.cb.2101002 OR https://manu60.magtech.com.cn/biotech/Y2021/V41/I4/18

引物名称	引物序列(5'- 3')	用途
PoCel_Fu	ATGAAGGGTTCCATCTCCTACC	Amplification of the Pocel7A^*
PoCel_Ru	TTACAGGCATGGGAGTAGTACTC
PoN137F	ACCTGCTGGAGGACGACACCACTTACCAGAAGTTCAACCTCCTGAACCAG	For site directed mutagenesis of Pocel7A
PoN137R	GGTAAGTGGTGTCGTCCTCCAGCAGGTAGAGACGAGAACCGATGT
TaCel_cF	ATGTATCAGAAACTAGCGG	Amplification of the Tacel7A cDNA
TaCel_cR	TTACAAGCACTGAGAGTAGTATTG
TaCel_Fu	ATGTATCAGAAACTAGCGGCAA	Amplification of the Tacel7A^*
TaCel_Ru	TTACAAGCACTGAGAGTAGTATTGG
TaN287F	CCATACCGCTTGGGCGACCACACTTTCTATGGCC	For site directed mutagenesis of Tacel7A
TaN287R	CCATAGAAAGTGTGGTCGCCCAAGCGGTATGGGT
5'PoCel_F1	GTCCGAAGAAAGGGTACAGC	Amplification of the 5' homologous region of Pocel7A
5'PoCel_R1	ATGCTCCTTCAATATCATCTTCTTGTGATGGATTGGATCAAAGATC
3'PoCel_F	TAATCCTTCTTTCTAGAGTCTTGAGTGGTCGTCGAGGTCCTGCTCG	Amplification of the 3' homologous region of Pocel7A
3'PoCel_R	AACTCCACCGCCACCGTCTC
G418_F1	GATCTTTGATCCAATCCATCACAAGAAGATGATATTGAAGGAGC	Amplification of the kan expression cassette
G418_R1	TCGACGACCACTCAAGACTCTAGAAAGAAGGATTACCTCT
5'PoCel_F2	GTCCGAAGAAAGGGTACAGC	Amplification of the 5' flanking region of cel7A expression cassette
5'PoCel_R2	AGGAGATGGAACCCTTCATTGTGATGGATTGGATCAAAGATCA
G418_F2	TAAAGAAGATGATATTGAAGGAG	Amplification of the kan
G418_R2	ACCTCGACGACCACTCAAGACTCTAGAAAGAAGGATTAC
G418_F3	TACTACTCTCAGTGCTTGTAAAGAAGATGATATTGAAGGAG
TaCel_F	TCTTTGATCCAATCCATCACAATGAAGGGTTCCATCTCCTACC	Amplification of the Tacel7A
TaCel_R	TCCTTCAATATCATCTTCTTTACAAGCACTGAGAGTAGTATTG
PoCel_F	TCTTTGATCCAATCCATCACAATGAAGGGTTCCATCTCCTAC	Amplification of the mutant Pocel7A^*
PoCel_R	TCCTTCAATATCATCTTCTTTACAGGCACTGGGAGTAGTAC
FuCel_F	AATCCTGCTCCAAGGTCGTT	Amplification of the cel7A expression cassette
FuCel_R	CGTGTCATGAGATTCCAACCTT
Vcel7AF	TGAGTTTCGCTGCTCCCAAG	For checking correct integration
VGR	ATCGATGCTTCGGTAGAATAGG
VGF	CTCAAGCCTACAGGACACAC
Vcel7AR	CTCAGGATGGTGTTTCAAGA
actin-qF	CTCCATCCAGGCCGTTC	qRT-PCR for quantification of actin
actin-qR	CATGAGGTAGTCGGTCAAG
bip1-qF	CCTGACGAGGCTGTTGCTTTC	qRT-PCR for quantification of bip1
bip1-qR	TGACGGAGTTACGGGGGATG
pdi1-qF	GCCCTCCATCGTTCTCTACAAG	qRT-PCR for quantification of pdi1
pdi1-qR	CTCGGCGAAGATGTAGGCAA
hac1-qF	ATAGTATCACCAGCCAGTCGC	qRT-PCR for quantification of hac1
hac1-qR	GGGATGAACTTTACCAATGCC

Table 1 Primers used in this study

Fig.1 The structure of PoCel7A and construction of N-glycosylation mutant PoCel7A^* (a) Three-dimensional structure of PoCel7A predicted by SWISS-MODEL. Asn137 is the pivotal N-glycosylation site (b) Cloning of Pocel7A cDNA and N-glycosylation site mutagenesis by PCR (c) Sequence diagram of PoCel7A Asn137 site directed mutagenesis

Fig.2 The structure of TaCel7A and construction of N-glycosylation mutant TaCel7A^* (a) Three-dimensional structure of TaCel7A predicted by SWISS-MODEL. Asn287 is the pivotal N-glycosylation site (b) Cloning of Tacel7A cDNA and N-glycosylation site mutagenesis by PCR (c) Sequence diagram of TaCel7A Asn287 site directed mutagenesis

Fig.3 Deletion of the Pocel7A in ΔPoxKu70 strain (a) Pocel7A deletion cassette (b) PCR amplification of Pocel7A deletion cassette. M:1 kb Marker; lane 1: 5' homologous region of Pocel7A; lane 2: kan expression cassette; lane 3: 3' homologous region of Pocel7A; lane 4: Pocel7A deletion cassette (c) PCR analysis of the parent strain ΔPoxKu70 and ΔPocel7A mutants. M: 1 kb Marker; lane 1~5: PCR products of transformants; Lane 6: PCR products of the parent strain ΔPoxKu70

Fig.4 Construction of cel7A expression strains Po/PoCel7A^*, Po/TaCel7A^* and Po/TaCel7 (a) Construction of Po/PoCel7A^*, Po/TaCel7A^* and Po/TaCel7A (b) Construction of cel7A expression cassettes. M: 1 kb Marker; lane 1: 5' homologous region of Pocel7A;lane 2: cel7A gene (Pocel7A^*, Tacel7A or Tacel7A^*); lane 3: kan expression cassette; lane 4: 3' homologous region of Pocel7A; lane 5: kan-3'Pocel7A fragment; lane 6: cel7A expression cassette (c) PCR analysis of the recombinants. M: 1 kb Marker; lane 1: PCR products of Po/PoCel7A^*; lane 2: PCR products of Po/TaCel7A; lane 3: PCR products of Po/TaCel7A^*; lane 4: PCR products of the parent strain ΔPoxKu70

Fig.5 Extracellular protein concentration of P. oxalicum recombinants (a) SDS-PAGE analysis of the supernatants of the parent strain ΔPoxKu70 and recombinants (b) The extracellular protein concentration of ΔPoxKu70 and recombinants

Fig.6 Cellulases activity of recombinants (a) pNPC activity of recombinants (b) FPase activity of recombinants (c) Avicelase activity of recombinants

Fig.7 Relative transcription level of genes involved in UPR in P. oxalicum strains


[1]	Himmel M E, Ding S Y, Johnson D K, et al. Biomass recalcitrance: engineering plants and enzymes for biofuels production. Science, 2007,315(5813):804-807. pmid: 17289988

[2]	Heinzelman P, Snow C D, Wu I, et al. A family of thermostable fungal cellulases created by structure-guided recombination. PNAS, 2009,106(14):5610-5615. pmid: 19307582

[3]	Aich S, Datta S. Engineering of a highly thermostable endoglucanase from the GH7 family of Bipolaris sorokiniana for higher catalytic efficiency. Applied Microbiology and Biotechnology, 2020,104(9):3935-3945. doi: 10.1007/s00253-020-10515-0 pmid: 32157426

[4]	Dotsenko A S, Rozhkova A M, Zorov I N, et al. Protein surface engineering of endoglucanase Penicillium verruculosum for improvement in thermostability and stability in the presence of 1-butyl-3-methylimidazolium chloride ionic liquid. Bioresource Technology, 2020,296:122370. pmid: 31734058

[5]	Margeot A, Hahn-Hagerdal B, Edlund M, et al. New improvements for lignocellulosic ethanol. Current Opinion in Biotechnology, 2009,20(3):372-380. doi: 10.1016/j.copbio.2009.05.009 pmid: 19502048

[6]	Markov A V, Gusakov A V, Kondratyeva E G, et al. New effective method for analysis of the component composition of enzyme complexes from Trichoderma reesei. Biochemistry (Moscow), 2005,70(6):657-663.

[7]	Amore A, Knott B C, Supekar N T, et al. Distinct roles of N- and O-glycans in cellulase activity and stability. PNAS, 2017,114(52):13667-13672. doi: 10.1073/pnas.1714249114 pmid: 29229855

[8]	Beckham G T, Dai Z Y, Matthews J F, et al. Harnessing glycosylation to improve cellulase activity. Current Opinion in Biotechnology, 2012,23(3):338-345. doi: 10.1016/j.copbio.2011.11.030 pmid: 22186222

[9]	Jeoh T, Michener W, Himmel M E, et al. Implications of cellobiohydrolase glycosylation for use in biomass conversion. Biotechnology for Biofuels, 2008,1(1):1-12. doi: 10.1186/1754-6834-1-1 pmid: 18471312

[10]	Kołaczkowski B M, Schaller K S, Sørensen T H, et al. Removal of n-linked glycans in cellobiohydrolase Cel7A from Trichoderma reesei reveals higher activity and binding affinity on crystalline cellulose. Biotechnology for Biofuels, 2020,13:136. pmid: 32782472

[11]	Boraston A B, Sandercock L E, Warren R A J, et al. O-glycosylation of a recombinant carbohydrate-binding module mutant secreted by Pichia pastoris. Journal of Molecular Microbiology and Biotechnology, 2003,5(1):29-36. doi: 10.1159/000068721 pmid: 12673059

[12]	Stals I, Sandra K, Geysens S, et al. Factors influencing glycosylation of Trichoderma reesei cellulases. I: Postsecretorial changes of the O- and N-glycosylation pattern of Cel7A. Glycobiology, 2004,14(8):713-724. pmid: 15070858

[13]	Rubio M V, Zubieta M P, Franco Cairo J P L, et al. Mapping n-linked glycosylation of carbohydrate-active enzymes in the secretome of Aspergillus nidulans grown on lignocellulose. Biotechnology for Biofuels, 2016,9:168. doi: 10.1186/s13068-016-0580-4 pmid: 27508003

[14]	Adney W S, Jeoh T, Beckham G T, et al. Probing the role of n-linked glycans in the stability and activity of fungal cellobiohydrolases by mutational analysis. Cellulose, 2009,16(4):699-709.

[15]	Voutilainen S P, Murray P G, Tuohy M G, et al. Expression of Talaromyces emersonii cellobiohydrolase Cel7A in Saccharomyces cerevisiae and rational mutagenesis to improve its thermostability and activity. Protein Engineering, Design and Selection, 2010,23(2):69-79.

[16]	Wei Y D, Lee S J, Lee K S, et al. N-glycosylation is necessary for enzymatic activity of a beetle (Apriona germari) cellulase. Biochemical and Biophysical Research Communications, 2005,329(1):331-336. doi: 10.1016/j.bbrc.2005.01.131 pmid: 15721311

[17]	Zhang Z, Liu J L, Lan J Y, et al. Predominance of Trichoderma and Penicillium in cellulolytic aerobic filamentous fungi from subtropical and tropical forests in China, and their use in finding highly efficient β-glucosidase. Biotechnology for Biofuels, 2014,7(1):1-14. doi: 10.1186/1754-6834-7-1 pmid: 24387051

[18]	Zhao S, Yan Y S, He Q P, et al. Comparative genomic, transcriptomic and secretomic profiling of Penicillium oxalicum HP7-1 and its cellulase and xylanase hyper-producing mutant EU2106, and identification of two novel regulatory genes of cellulase and xylanase gene expression. Biotechnology for Biofuels, 2016,9:203. pmid: 27688806

[19]	Huang Y P, Qin X L, Luo X M, et al. Efficient enzymatic hydrolysis and simultaneous saccharification and fermentation of sugarcane bagasse pulp for ethanol production by cellulase from Penicillium oxalicum EU2106 and thermotolerant Saccharomyces cerevisiae ZM1-5. Biomass and Bioenergy, 2015,77:53-63.

[20]	Livak K J, Schmittgen T D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods, 2001,25(4):402-408. doi: 10.1006/meth.2001.1262 pmid: 11846609

[21]	Textor L C, Colussi F, Silveira R L, et al. Joint X-ray crystallographic and molecular dynamics study of cellobiohydrolase I from Trichoderma harzianum: deciphering the structural features of cellobiohydrolase catalytic activity. The FEBS Journal, 2013,280(1):56-69. doi: 10.1111/febs.12049 pmid: 23114223

[22]	Rocha V A, Maeda R N, Pereira N, et al. Characterization of the cellulolytic secretome of Trichoderma harzianum during growth on sugarcane bagasse and analysis of the activity boosting effects of swollenin. Biotechnology Progress, 2016,32(2):327-336. doi: 10.1002/btpr.2217 pmid: 26697775

[23]	Schneider W D H, Gonçalves T A, Uchima C A, et al. Penicillium echinulatum secretome analysis reveals the fungi potential for degradation of lignocellulosic biomass. Biotechnology for Biofuels, 2016,9:66. pmid: 26989443

[24]	Florencio C, Cunha F M, Badino A C, et al. Secretome analysis of Trichoderma reesei and Aspergillus niger cultivated by submerged and sequential fermentation processes: enzyme production for sugarcane bagasse hydrolysis. Enzyme and Microbial Technology, 2016,90:53-60. doi: 10.1016/j.enzmictec.2016.04.011 pmid: 27241292

[25]	马亚楠, 王明钰, 徐海. 纤维素酶的糖基化. 微生物学报, 2017,57(12):1761-1768.

[25]	Ma Y N, Wang M Y, Xu H. Progress in cellulase glycosylation. Acta Microbiologica Sinica, 2017,57(12):1761-1768.

[26]	Qi F F, Zhang W X, Zhang F J, et al. Deciphering the effect of the different N-glycosylation sites on the secretion, activity, and stability of cellobiohydrolase I from Trichoderma reesei. Applied and Environmental Microbiology, 2014,80(13):3962-3971. doi: 10.1128/AEM.00261-14 pmid: 24747898

[27]	Wu G C, Wei L G, Liu W F, et al. Asn64-glycosylation affects Hypocrea jecorina (syn. Trichoderma reesei) cellobiohydrolase Cel7A activity expressed in Pichia pastoris. World Journal of Microbiology and Biotechnology, 2010,26(2):323-328.

[28]	Guan B, Chen F X, Su S, et al. Effects of co-overexpression of secretion helper factors on the secretion of a HSA fusion protein (IL2-HSA) in Pichia pastoris. Yeast, 2016,33(11):587-600.

[29]	Tang H T, Bao X M, Shen Y, et al. Engineering protein folding and translocation improves heterologous protein secretion in Saccharomyces cerevisiae. Biotechnology and Bioengineering, 2015,112(9):1872-1882. doi: 10.1002/bit.25596 pmid: 25850421

[30]	Heimel K. Unfolded protein response in filamentous fungi-implications in biotechnology. Applied Microbiology and Biotechnology, 2015,99(1):121-132. pmid: 25384707

[1]	XU Xiao, CHENG Chi, YUAN Kai, XUE Chuang. Research Progress of Cellulase Production in Trichoderma reesei[J]. China Biotechnology, 2021, 41(1): 52-61.

[2]	HU Yi-bo,PI Chang-yu,ZHANG Zhe,XIANG Bo-yu,XIA Li-qiu. Recent Advances in Protein Expression System of Filamentous Fungi[J]. China Biotechnology, 2020, 40(5): 94-104.

[3]	Qing-meng LI,Sheng-tao LI,Ning WANG,Xiao-dong GAO. Expression, Purification and Activity Assay of Yeast α-1,2 Mannosyltransferase Alg11[J]. China Biotechnology, 2018, 38(6): 26-33.

[4]	Ying-ying ZHANG,Bin TANG,Guo-cheng DU. Study on the Intracellular Glycosyl Donor and Structural Function of Cellobiose Synthase from Rhizopus stolonifer[J]. China Biotechnology, 2018, 38(4): 38-45.

[5]	MENG Qing-ting, TANG Bin. The Role of Carbon Metabolism Repressor CRE in the Regulation of Cellulase Produced by Rhizopus stolonifer[J]. China Biotechnology, 2016, 36(3): 31-37.

[6]	LIANG Xiang nan, ZHANG Kun, ZOU Shao lan, WANG Jian jun, MA Yuan yuan, HONG Jie fang. *Construction and Preliminary Evaluation of Saccharomyces cerevisiae* Strains Co-expressing Three Types of Cellulase Via Cocktail δ-integration**[J]. China Biotechnology, 2016, 36(11): 54-62.

[7]	ZHAO Feng, ZHANG Yi-jun, RAN Yan-hong, WANG Xing-yong, YE Qian-jun, LI Hong-jian. Analysis of rhIL-12 Disulfide Bond And N-glycosylation Sites and C-terminal Amino Acid Sequence[J]. China Biotechnology, 2014, 34(5): 39-53.

[8]	WU Qiong, WANG Meng, LI Ya-Qian, GAO Shi-Gang, YU Chuan-Jin, SUN Jia-Nan, ZHANG Tai-Long, CHEN Jie. *Characterization of Cellulase Solution Produced by Leptosphaerulina chartarum* SJTU59 and Analysis of Conserved Regions of Cellulase Genes**[J]. China Biotechnology, 2014, 34(3): 61-67.

[9]	YANG Hua-jun, ZOU Shao-lan, LIU Cheng, MA Yuan-yuan, MA Xiang-xia, HONG Jie-fang. Advance in Research on Cellulase Expression in Saccharomyces cerevisiae[J]. China Biotechnology, 2014, 34(06): 75-83.

[10]	CAI Jing-jing, DUAN Xue-hui, XIE Liang, ZHENG Xi-fang, SHEN Jiang-tao. Production of Cellulases by Solid State Fermentation with Three Strains Mixed[J]. China Biotechnology, 2013, 33(7): 57-63.

[11]	XIE Chun-fang, LI Yu-feng, LIU Da-ling, YAO Dong-sheng. The Stability Reconstruction of β-mannanase with N-glycosylation Modification[J]. China Biotechnology, 2013, 33(12): 79-85.

[12]	MA Zhong-rui, HAN Dong-lei, ZHAO Jun-fei, CHEN Meng-lin, CHEN Min. *Recent Developments in N-linked Glycoproteins Production in Escherichia coli* and Glycoprotein Vaccines**[J]. China Biotechnology, 2013, 33(11): 92-98.

[13]	GU Rui-meng, LI Yong-hao, TIAN Chao-guang. *The Medium Optimization of Cellulases Fermentation of Neurospora crassa* by Response Surface Methodology**[J]. China Biotechnology, 2012, 32(03): 76-82.

[14]	CHEN Ke, HUANG Xiao, LU Lei, XING Yun, HOU Jing, WU Jie, LIU Jing-jing. *Comparison of celY* Gene from Erwinia chrysanthemi Expression in Escherichia coli Driven by Different Regulatory Elements**[J]. China Biotechnology, 2012, 32(02): 24-28.

[15]	QIN Hui-bin, YANG Hong-jiang, HUANG Wen, LI Ling-yan. Expression of cbhB Gene Driven by Promoter glaA in Aspergillus niger[J]. China Biotechnology, 2010, 30(11): 34-38.

Viewed

Full text

Abstract

Cited

Shared

Discussed