Please wait a minute...

中国生物工程杂志

China Biotechnology
China Biotechnology  2020, Vol. 40 Issue (6): 10-19    DOI: 10.13523/j.cb.1912021
    
Role and Mechanism of Ozanimod (RPC1063) in Oligodendrocyte Precursor Cell Differentiation
ZHANG Ying1,2,KONG Xiang-xi2,HOU Lin1,WANG Shu-kun2,**(),YUAN Zeng-qiang1,2,**()
1 School of Basic Medicine, Qingdao University, Qingdao 266071, China
2 Institute of Military Cognition and Brain Sciences, Academy of Military Medical Sciences, Beijing 100850, China
Download: HTML   PDF(2116KB) HTML
Export: BibTeX | EndNote (RIS)      

Abstract  

Objective: This study aims to pinpoint the role of Ozanimod (RPC1063) in the differentiation of oligodendrocyte precursor cell (OPC) and investigate the underlying molecular mechanism.Methods: OPC was directly isolated by immune adsorption and indentified through immunofluorescence and quantitative real time-PCR. Firstly, the mRNA level of S1pr family genes was detected by qRT-PCR during the cerebral cortex development and OPC differentiation. Then, viability of OPC treated with different concentrations of RPC1063 was measured by MTT assay and ATP cell viability assay. Moreover, by means of immunofluorescence, qRT-PCR, and Western blot, we analysed the effects of RPC1063 on the differentiation rate of OPC, and the mRNA or protein level of OPC-differentiation associated genes.Results: High purity of OPC could be obtained by the method of immune adsorption from the cortex of mice. There was no significant effect of RPC1063 on cell viability at concentrations of 0, 0.1, 1, 5, 50, 100nmol/L. Additionally, up-regulation of O4+ or MBP+ cells, and protein level of MBP and mRNA level of Mbp, Sox10, Cnp, or Plp were observed in OPC treated with RPC1063. Moreover, in RPC1063-treated Oli-neu cells, the protein levels of pAKT, p-mTOR and p-4EBP1 were significantly increased at 5min. Besides, the proteins related to p-AKT-mTOR signaling pathway were also significantly increased in OPC. The promotion of RPC1063 on OPC differentiation was weakened by the inhibition of mTOR pathway.Conclusion: RPC1063 promotes the differentiation of oligodendrocyte precursor cell through activating the AKT-mTOR signaling pathway.



Key wordsOzanimod (RPC1063)      Oligodendrocyte precursor cell      Demylinating diseases     
Received: 14 December 2019      Published: 23 June 2020
ZTFLH:  Q291  
Corresponding Authors: Shu-kun WANG,Zeng-qiang YUAN     E-mail: wangshukun954215@163.com;zqyuan@bmi.ac.cn
Cite this article:

ZHANG Ying,KONG Xiang-xi,HOU Lin,WANG Shu-kun,YUAN Zeng-qiang. Role and Mechanism of Ozanimod (RPC1063) in Oligodendrocyte Precursor Cell Differentiation. China Biotechnology, 2020, 40(6): 10-19.

URL:

https://manu60.magtech.com.cn/biotech/10.13523/j.cb.1912021     OR     https://manu60.magtech.com.cn/biotech/Y2020/V40/I6/10

Gene Forward primer Reverse primer
S1pr1 ATGGTGTCCACTAGCATCCC CGATGTTCAACTTGCCTGTGTAG
S1pr3 ACTCTCCGGGAACATTACGAT CAAGACGATGAAGCTACAGGTG
S1pr4 GTCAGGGACTCGTACCTTCCA GATGCAGCCATACACACGG
S1pr5 GCTTTGGTTTGCGCGTGAG GGCGTCCTAAGCAGTTCCAG
Pdgfrα ACACGTTTGAGCTGTCAACC CCCGACCACACAAGAACAGG
Olig2 GGGAGGTCATGCCTTACGC CTCCAGCGAGTTGGTGAGC
Mbp GACCATCCAAGAAGACCCCAC GCCATAATGGGTAGTTCTCGTGT
Cnp TTTACCCGCAAAAGCCACACA CACCGTGTCCTCATCTTGAAG
Mag CTGCCGCTGTTTTGGATAATGA CATCGGGGAAGTCGAAACGG
Sox10 ACACCTTGGGACACGGTTTTC TAGGTCTTGTTCCTCGGCCAT
β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT
Table 1 qRT-PCR primers
Fig.1 Isolation and identification of OPC (a) Pattern diagram of OPC separation by immunosorbent assay in vitro (b) Immunostainings of PDGFRα (green) and Olig2 (red) in the cultured OPCs (c) Relative gene expression (Pdgfrα, Olig2, Sox10, Mbp, Cnp) in cells at 0、2、5days.
Fig.2 Expression levels of the S1PR family in brain development and OPC (a) The mRNA level of S1pr1 and S1pr5 in the whole brain during the different stage of development (b) The mRNA level of S1pr1, S1pr3, S1pr4 and S1pr5 in OPC differentiation
Fig.3 Effect of RPC1063 on OPC viability and morphology (a-b) OPC viability was detected by ATP cell viability assay (a) and MTT asssy (b) after the treatment of different concentrations of RPC1063 (0, 0.1nmol/L, 1nmol/L, 5nmol/L, 50nmol/L, 100nmol/L) for 24h (c) Immunostainings of PDGFRα (green) and Olig2 (red) in OPC after 24h of RPC1063 treatment. N.S. There is no significant difference
Fig.4 RPC1063 promotes OPC differentiation (a, c) Immunostainings of O4 (red) (a) and MBP (red) (c) in OPC after 100nmol/L RPC1063 treatment for 24h. (b, d) Statistics of (a) and (c), * P<0.05; ** P<0.01 (e) The mRNA level of Pdgfrα, Mbp, Mag, Sox10 and Cnp in OPC after 10nmol/L RPC1063 treatment for 24h, ** P<0.01 (f) The protein expression of MBP in OPC after 10nmol/L or 100nmol/L RPC1063 treatment for 48h (g) Expression level of MBP proteins expression normalized to β-actin of (f), ** P<0.01
Fig.5 The mechanism of RPC1063 promoting OPC differentiation (a) Western blot analysis of p-AKT, AKT, p-mTOR, mTOR, p-4EBP1, 4EBP1 expression using the indicated antibody in Oli-neu after 100nmol/L RPC1063 treatment for 0min, 5min, 10min and 30min, respectively (b-d) Quantification of p-AKT/AKT, p-mTOR/mTOR, p-4EBP1/4EBP1. * P<0.05 (e) Western blot analysis of proteins expression using the indicated antibody in OPC after 0, 5min of 100nmol/L RPC1063 treatment (f) Western blot analysis of protein expression using the indicated antibody in OPC after 0, 48h of 100nmol/L RPC1063 treatment (g) Western blot analysis of MBP expression in cells treated with Ctrl, RPC1063, RPC1063+Rapa or Rapa (h) Immunostainings of MBP (red) in OPCs differentiated in the presence of Ctrl, RPC1063, RPC1063+Rapa or Rapa (i) The mRNA level of Mbp, Mag, Sox10 * P<0.05; ** P<0.01 (j) The model shows that the role and mechanism of Ozanimod (RPC1063) in OPC differentiation
[1]   Rosenthal J F, Hoffman B M, Tyor W R . CNS inflammatory demyelinating disorders: MS, NMOSD and MOG antibody associated disease. J Investig Med, 2020,68(2):321-330.
pmid: 31582425
[2]   Vega-Riquer J M, Mendez-Victoriano G, Morales-Luckie R A , et al. Five decades of cuprizone, an updated model to replicate demyelinating diseases. Curr Neuropharmacol, 2019,17(2):129-141.
pmid: 28714395
[3]   Hartley M D, Banerji T, Tagge I J , et al. Myelin repair stimulated by CNS-selective thyroid hormone action. JCI Insight, 2019,4(8):e126329.
[4]   Akaishi T, Nakashima I . Efficiency of antibody therapy in demyelinating diseases. Int Immunol, 2017,29(7):327-335.
[5]   Höftberger R, Lassmann H . Inflammatory demyelinating diseases of the central nervous system. Handb Clin Neurol, 2017,145:263-283.
[6]   Franklin R J, Ffrench-Constant C . Remyelination in the CNS: from biology to therapy. Nat Rev Neurosci, 2008,9(11):839-855.
pmid: 18931697
[7]   Franco P G, Silvestroff L, Soto E F , et al. Thyroid hormones promote differentiation of oligodendrocyte progenitor cells and improve remyelination after cuprizone-induced demyelination. Exp Neurol, 2008,212(2):458-467.
doi: 10.1016/j.expneurol.2008.04.039 pmid: 18572165
[8]   Mi S, Miller R H, Tang W , et al. Promotion of central nervous system remyelination by induced differentiation of oligodendrocyte precursor cells. Ann Neurol, 2009,65(3):304-315.
[9]   Brinkmann V . Sphingosine 1-phosphate receptors in health and disease: mechanistic insights from gene deletion studies and reverse pharmacology. Pharmacol Ther, 2007,115(1):84-105.
[10]   Martin R, Sospedra M . Sphingosine-1 phosphate and central nervous system. Curr Top Microbiol Immunol, 2014,378:149-170.
doi: 10.1007/978-3-319-05879-5_7 pmid: 24728597
[11]   Zhang J, Zhang Z G, Li Y , et al. Fingolimod treatment promotes proliferation and differentiation of oligodendrocyte progenitor cells in mice with experimental autoimmune encephalomyelitis. Neurobiol Dis, 2015,76:57-66.
[12]   Khatri B O . Fingolimod in the treatment of relapsing-remitting multiple sclerosis: long-term experience and an update on the clinical evidence. Ther Adv Neurol Disord, 2016,9(2):130-147.
[13]   Cohen J A, Barkhof F, Comi G , et al. Oral fingolimod or intramuscular interferon for relapsing multiple sclerosis. N Engl J Med, 2010,362(5):402-415.
doi: 10.1056/NEJMoa0907839 pmid: 20089954
[14]   Taylor Meadows K R, Steinberg M W, Clemons B , et al. Ozanimod (RPC1063), a selective S1PR1 and S1PR5 modulator, reduces chronic inflammation and alleviates kidney pathology in murine systemic lupus erythematosus. PLoS One, 2018,13(4):e0193236.
doi: 10.1371/journal.pone.0193236 pmid: 29608575
[15]   Cohen J A, Arnold D L, Comi G , et al. Safety and efficacy of the selective sphingosine 1-phosphate receptor modulator ozanimod in relapsing multiple sclerosis (RADIANCE): a randomised, placebo-controlled, phase 2 trial. Lancet Neurol, 2016,15(4):373-381.
[16]   Cohen J A, Comi G, Arnold D L , et al. Efficacy and safety of ozanimod in multiple sclerosis: Dose-blinded extension of a randomized phase II study. Mult Scler, 2019,25(9):1255-1262.
pmid: 30043658
[17]   Cohen J A, Comi G, Selmaj K W , et al. Safety and efficacy of ozanimod versus interferon beta-1a in relapsing multiple sclerosis (RADIANCE): a multicentre, randomised, 24-month, phase 3 trial. Lancet Neurol, 2019,18(11):1021-1033.
pmid: 31492652
[18]   Rasche L, Paul F . Ozanimod for the treatment of relapsing remitting multiple sclerosis. Expert Opin Pharmacother, 2018,19(18):2073-2086.
[19]   Chaudhry B Z, Cohen J A, Conway D S . Sphingosine 1-phosphate receptor modulators for the treatment of multiple sclerosis. Neurotherapeutics, 2017,14(4):859-873.
doi: 10.1007/s13311-017-0565-4 pmid: 28812220
[20]   Wang L, Yang H, Zang C , et al. CXCR2 antagonism promotes oligodendrocyte precursor cell differentiation and enhances remyelination in a mouse model of multiple sclerosis. Neurobiol Dis, 2020,134:104630.
doi: 10.1016/j.nbd.2019.104630 pmid: 31678404
[21]   Varas R, Ortiz F C . Neuroinflammation in demyelinating diseases: oxidative stress as a modulator of glial cross-talk. Curr Pharm Des, 2019,25(45):4755-4762.
doi: 10.2174/1381612825666191216125725 pmid: 31840603
[22]   Qiu K, He Q, Chen X , et al. Pregnancy-related immune changes and demyelinating diseases of the central nervous system. Front Neurol, 2019,10:1070.
doi: 10.3389/fneur.2019.01070 pmid: 31649614
[23]   Scott F L, Clemons B, Brooks J , et al. Ozanimod (RPC1063) is a potent sphingosine-1-phosphate receptor-1 (S1P1) and receptor-5 (S1P5) agonist with autoimmune disease-modifying activity. British Journal of Pharmacology, 2016,173(11):1778-1792.
[24]   Wong K K . Recent developments in anti-cancer agents targeting the Ras/Raf/ MEK/ERK pathway. Recent Pat Anticancer Drug Discov, 2009,4(1):28-35.
doi: 10.2174/157489209787002461 pmid: 19149686
[25]   Sun X, Liu Y, Liu B , et al. Rolipram promotes remyelination possibly via MEK-ERK signal pathway in cuprizone-induced demyelination mouse. Exp Neurol, 2012,237(2):304-311.
pmid: 22836144
[1] TAN Pei-lin,ZHANG Ying,ZHANG Jun,GAO Xiao,WANG Shu-kun,HOU Lin,YUAN Zeng-qiang. Role and Mechanism of Metformin in Oligodendrocyte Precursor Cell Differentiation[J]. China Biotechnology, 2021, 41(9): 1-9.
[2] LI Zhen, LIU Zhao-yu, XU Dan, CHEN Ting, MENG Zan, TANG Yong, PENG Yan. Astrocyte Promotes Oligodendrocyte Precursor Cell Proliferating through Connexion CX47[J]. China Biotechnology, 2015, 35(12): 21-29.