Please wait a minute...

中国生物工程杂志

China Biotechnology
China Biotechnology  2023, Vol. 43 Issue (5): 1-10    DOI: 10.13523/j.cb.2212013
    
Mice Lacking Prmt5 in Cerebral Vascular Endothelial Cells Showing Microglial Activation and Protecting Blood-brain Barrier Integrity
HAN Yu-ying1,2,NING Hui-min1,2,ZHANG Yi-zhe2,SONG Xiao-peng2,XU Cheng-fang2,CAI Yun-ting2,YANG Xiao1,2,**(),WANG Jun2,**()
1 School of Basic Medicine, Qingdao University, Qingdao 266071, China
2 State Key Laboratory of Proteomics, Beijing National Center for Protein Sciences (Beijing), Beijing Institute of Lifeomics, Beijing 102206, China
Download: HTML   PDF(2131KB) HTML
Export: BibTeX | EndNote (RIS)      

Abstract  

Objective: Endothelial cells (ECs) together with pericytes, microglia, astrocytes and neurons, form a neurovascular unit (NVU) that constitutes the blood-brain barrier (BBB). However, the role of microglia in the maintenance of the BBB remains under debate. Protein arginine methyltransferase 5 (PRMT5) is the main catalyzing arginine symmetric dimethylation methyltransferase in vivo. Our previous work found that cerebral vascular EC-specific Prmt5 gene knockout resulted in severe cerebrovascular lesions and impaired BBB. Whether microglia are activated in cerebral vascular lesions caused by Prmt5 gene knockout in cerebral vascular ECs is investigated, and microglia’s effects on the BBB permeability are explored. Methods: SP-A-Cre transgenic mice were bred with Prmt5fl/fl conditional gene targeting mice, the knock-in mice with Rosa26tdTomato (RFP) reporter lines, to generate cerebral vascular ECs Prmt5 gene knockout (Prmt5fl/fl) mice. To examine whether microglia are activated in the cerebral vascular ECs Prmt5fl/fl mice, Ionized Calcium Binding Adaptor Molecule 1 (IBA1) expression levels in the cortex, thalamus and cerebellum of the mice in the control group and Prmt5fl/fl mice were detected by immunofluorescence and Western blot. The M1 microglial markers of the cluster of differentiation 86 (CD86), the cluster of differentiation 16 (CD16), tumor necrosis factor alpha (TNF-α) and M2 microglial markers of chitinase-like protein 3 (Chil3/Ym1), arginase 1 (Arg1), and Interleukin-10 (IL-10) were detected by real-time quantitative PCR and Western blot to evaluate the microglial polarization in different brain regions. CSF1R inhibitor PLX5622 was intraperitoneally injected into the mice in the control group and Prmt5fl/fl mice to deplete microglia. IBA1 expression level was detected by immunofluorescence and real-time quantitative PCR to evaluate the efficiency of microglial depletion. Sulfo-NHS-Biotin was intraperitoneally injected into the mice in the control group and Prmt5fl/fl mice to examine the BBB integrity. Results: The expression level of IBA1 increased significantly in the cortex, thalamus and cerebellum. The IBA1 and CD68 double positive cells accumulated in the thalamic lesion area of Prmt5fl/fl mice showed that knockout of Prmt5 gene in cerebral vascular ECs led to activation of microglia. The expression of M1 markers (CD16, CD86 and TNF-α) and M2 markers (Ym1, Arg1 and IL-10) were up-regulated in the cortex, thalamus and cerebellum in cerebral vascular ECs of Prmt5fl/fl mice. PLX5622 treatment resulted in microglial depletion with a depletion efficiency of more than 70%. Depletion of microglia leads to increased BBB permeability of Prmt5fl/fl mice. Conclusion: Deletion of Prmt5 in cerebrovascular ECs leads to activation of microglia, which may be involved in the maintenance of the BBB integrity.



Key wordsMicroglia      Cerebral vascular endothelial cell      Prmt5      Blood-brain barrier     
Received: 06 December 2022      Published: 01 June 2023
ZTFLH:  Q819  
Cite this article:

HAN Yu-ying, NING Hui-min, ZHANG Yi-zhe, SONG Xiao-peng, XU Cheng-fang, CAI Yun-ting, YANG Xiao, WANG Jun. Mice Lacking Prmt5 in Cerebral Vascular Endothelial Cells Showing Microglial Activation and Protecting Blood-brain Barrier Integrity. China Biotechnology, 2023, 43(5): 1-10.

URL:

https://manu60.magtech.com.cn/biotech/10.13523/j.cb.2212013     OR     https://manu60.magtech.com.cn/biotech/Y2023/V43/I5/1

Name Sequence(5'→3')
GAPDH TGCCCAGAACATCATCCCT
GAPDH GGTCCTCAGTGTAGCCCAAG
IBA1 CAAGGATTTGCAGGGAGGAA
IBA1 CTTGGGATCATCGAGGAAGTG
CD86 ACGATGGACCCCAGATGCACCA
CD86 GCGTCTCCACGGAAACAGCA
CD16 GCCAATGGCTACTTCCACCAC
CD16 GTCCAGTTTCACCACAGCCTTC
TNF-α AGCAAACCACCAAGTGGAGGA
TNF-α GCTGGCACCACTAGTTGGTTGT
Arg1 TTAGGCCAAGGTGCTTGCTGCC
Arg1 TACCATGGCCCTGAGGAGGTTC
Ym1 ACCCCTGCCTGTGTACTCACCT
Ym1 CACTGAACGGGGCAGGTCCAAA
IL-10 GGCAGAGAACCATGGCCCAGAA
IL-10 AATCGATGACAGCGCCTCAGCC3
Table 1 Real-time PCR primer sequences
Fig.1 Knockout of Prmt5 gene in cerebrovascular endothelial cells led to activation of microglia (a) Expression of microglia in cerebrovascular endothelial cells Prmt5 gene knockout mice. IBA1 (green) was used to label microglia, and DAPI (blue) was used to label nucleus. Scale bar was 100 μm (b)Quantitative analysis of IBA1+cell. n=3, * P< 0.05, ** P< 0.01, *** P<0.001 (c) Western blot analysis of microglia expression in different brain regions of Prmt5 gene knockout mice. n=3 (d) Quantitative analysis of Western blot. n=4, * P<0.05 (e) Immunostaining analysis of brain sections for CD68(green) and IBA1(red). Scale bar was 50 μm
Fig.2 Knockout of Prmt5 gene in cerebrovascular endothelial cells upregulate M1 and M2 markers of microglia Real-time PCR(a) and Western blot(c) were used to detect the expression level of M1 markers, n=3 or n=4, * P<0.05, ** P<0.01, *** P<0.001 Real-time PCR (b) and Western blot (e) were used to detect the expression levels of M2 markers, n=3 or n=4, * P< 0.05, ** P<0.01, *** P<0.001 (d),(f)Quantitative analysis of Western blot, n=3 or n=4, * P<0.05, ** P<0.01
Fig.3 PLX5622 treatment resulted in microglial depletion and worsened the BBB leakage phenotype of Prmt5 gene knockout mice (a) Real-time PCR was used to analyze the depletion of microglia after PLX5622 treatment. n=3, ** P<0.01 (b) Immunofluorescence staining of microglia in Prmt5 gene knockout mice after PLX5622 treatment. Scale bar was 100 μm (c) Immunofluorescence staining of brain tissue sections from Prmt5 gene knockout mice mice after Sulfo-NHS-Biotin injections, green represents Sulfo-NHS-Biotin. Scale bar was 1 000 μm
[1]   Zhao Z, Nelson A R, Betsholtz C, et al. Establishment and dysfunction of the blood-brain barrier. Cell, 2015, 163(5): 1064-1078.
doi: S0092-8674(15)01423-3 pmid: 26590417
[2]   Sweeney M D, Zhao Z, Montagne A, et al. Blood-brain barrier: from physiology to disease and back. Physiological Reviews, 2019, 99(1): 21-78.
doi: 10.1152/physrev.00050.2017 pmid: 30280653
[3]   Winkler E A, Bell R D, Zlokovic B V. Pericyte-specific expression of PDGF beta receptor in mouse models with normal and deficient PDGF beta receptor signaling. Molecular Neurodegeneration, 2010, 5: 32.
doi: 10.1186/1750-1326-5-32 pmid: 20738866
[4]   Willis C L, Nolan C C, Reith S N, et al. Focal astrocyte loss is followed by microvascular damage, with subsequent repair of the blood-brain barrier in the apparent absence of direct astrocytic contact. Glia, 2004, 45(4): 325-337.
pmid: 14966864
[5]   Liebner S, Dijkhuizen R M, Reiss Y, et al. Functional morphology of the blood-brain barrier in health and disease. Acta Neuropathologica, 2018, 135(3): 311-336.
doi: 10.1007/s00401-018-1815-1 pmid: 29411111
[6]   Walsh J, Tozer D J, Sari H S, et al. Microglial activation and blood-brain barrier permeability in cerebral small vessel disease. Brain: a Journal of Neurology, 2021, 144(5): 1361-1371.
doi: 10.1093/brain/awab003
[7]   Ueno M, Fujita Y, Tanaka T, et al. Layer V cortical neurons require microglial support for survival during postnatal development. Nature Neuroscience, 2013, 16(5): 543-551.
doi: 10.1038/nn.3358 pmid: 23525041
[8]   Fu R Y, Shen Q Y, Xu P F, et al. Phagocytosis of microglia in the central nervous system diseases. Molecular Neurobiology, 2014, 49(3): 1422-1434.
doi: 10.1007/s12035-013-8620-6 pmid: 24395130
[9]   Paolicelli R C, Bolasco G, Pagani F, et al. Synaptic pruning by microglia is necessary for normal brain development. Science, 2011, 333(6048): 1456-1458.
doi: 10.1126/science.1202529 pmid: 21778362
[10]   Girard S, Brough D, Lopez-Castejon G, et al. Microglia and macrophages differentially modulate cell death after brain injury caused by oxygen-glucose deprivation in organotypic brain slices. Glia, 2013, 61(5): 813-824.
doi: 10.1002/glia.22478 pmid: 23404620
[11]   Hu X M, Leak R K, Shi Y J, et al. Microglial and macrophage polarization:new prospects for brain repair. Nature Reviews Neurology, 2015, 11(1): 56-64.
doi: 10.1038/nrneurol.2014.207
[12]   Ma Y Y, Wang J X, Wang Y T, et al. The biphasic function of microglia in ischemic stroke. Progress in Neurobiology, 2017, 157: 247-272.
doi: S0301-0082(15)30070-8 pmid: 26851161
[13]   Haruwaka K, Ikegami A, Tachibana Y, et al. Dual microglia effects on blood brain barrier permeability induced by systemic inflammation. Nature Communications, 2019, 10(1): 1-17.
doi: 10.1038/s41467-018-07882-8
[14]   Blanc R S, Richard S. Arginine methylation: the coming of age. Molecular Cell, 2017, 65(1): 8-24.
doi: S1097-2765(16)30711-0 pmid: 28061334
[15]   Wu Q, Schapira M, Arrowsmith C H, et al. Protein arginine methylation: from enigmatic functions to therapeutic targeting. Nature Reviews Drug Discovery, 2021, 20(7): 509-530.
doi: 10.1038/s41573-021-00159-8 pmid: 33742187
[16]   Quillien A, Gilbert G, Boulet M, et al. Prmt5 promotes vascular morphogenesis independently of its methyltransferase activity. PLoS Genetics, 2021, 17(6): e1009641.
doi: 10.1371/journal.pgen.1009641
[17]   宁慧敏, 张一哲, 韩钰莹, 等. 脑血管内皮细胞敲除Prmt5导致脑血管损伤及星形胶质细胞活化. 中国生物工程杂志, 2022, 42(4): 1-8.
[17]   Ning H M, Zhang Y Z, Han Y Y, et al. Deletion of Prmt 5 in cerebral endothelial cells leads to cerebrovascular disease and astrocyte activation. China Biotechnology, 2022, 42(4): 1-8.
[18]   Li F F, Lan Y, Wang Y L, et al. Endothelial Smad4 maintains cerebrovascular integrity by activating N-cadherin through cooperation with Notch. Developmental Cell, 2011, 20(3): 291-302.
doi: 10.1016/j.devcel.2011.01.011 pmid: 21397841
[19]   Li Z, Lan Y, He W Y, et al. Mouse embryonic head as a site for hematopoietic stem cell development. Cell Stem Cell, 2012, 11(5): 663-675.
doi: 10.1016/j.stem.2012.07.004 pmid: 23122290
[20]   Bassett B, Subramaniyam S, Fan Y, et al. Minocycline alleviates depression-like symptoms by rescuing decrease in neurogenesis in dorsal hippocampus via blocking microglia activation/phagocytosis. Brain, Behavior, and Immunity, 2021, 91: 519-530.
doi: 10.1016/j.bbi.2020.11.009 pmid: 33176182
[21]   Lan X, Han X N, Li Q, et al. Modulators of microglial activation and polarization after intracerebral haemorrhage. Nature Reviews Neurology, 2017, 13(7): 420-433.
doi: 10.1038/nrneurol.2017.69 pmid: 28524175
[22]   Chiu I, Morimoto E A, Goodarzi H, et al. A neurodegeneration-specific gene-expression signature of acutely isolated microglia from an amyotrophic lateral sclerosis mouse model. Cell Reports, 2013, 4(2): 385-401.
doi: 10.1016/j.celrep.2013.06.018 pmid: 23850290
[23]   Morganti J M, Riparip L K, Rosi S. Call off the dog(ma): M1/M2 polarization is concurrent following traumatic brain injury. PLoS One, 2016, 11(1): e0148001.
doi: 10.1371/journal.pone.0148001
[24]   Waisman A, Ginhoux F, Greter M, et al. Homeostasis of microglia in the adult brain: review of novel microglia depletion systems. Trends in Immunology, 2015, 36(10): 625-636.
doi: S1471-4906(15)00197-0 pmid: 26431940
[25]   Elmore M P, Najafi A, Koike M, et al. Colony-stimulating factor 1 receptor signaling is necessary for microglia viability, unmasking a microglia progenitor cell in the adult brain. Neuron, 2014, 82(2): 380-397.
doi: 10.1016/j.neuron.2014.02.040 pmid: 24742461
[26]   Rice R A, Pham J, Lee R J, et al. Microglial repopulation resolves inflammation and promotes brain recovery after injury. Glia, 2017, 65(6): 931-944.
doi: 10.1002/glia.23135 pmid: 28251674
[27]   Chen A Q, Fang Z, Chen X L, et al. Microglia-derived TNF-α mediates endothelial necroptosis aggravating blood brain-barrier disruption after ischemic stroke. Cell Death & Disease, 2019, 10(7): 1-18.
[28]   Parkhurst C, Yang G, Ninan I, et al. Microglia promote learning-dependent synapse formation through brain-derived neurotrophic factor. Cell, 2013, 155(7): 1596-1609.
doi: 10.1016/j.cell.2013.11.030 pmid: 24360280
[29]   Li Y F, Ren X, Zhang L, et al. Microglial polarization in TBI: Signaling pathways and influencing pharmaceuticals. Frontiers in Aging Neuroscience, 2022, 14: 901117.
doi: 10.3389/fnagi.2022.901117
[30]   Hu X M, Li P Y, Guo Y L, et al. Microglia/macrophage polarization dynamics reveal novel mechanism of injury expansion after focal cerebral ischemia. Stroke, 2012, 43(11): 3063-3070.
doi: 10.1161/STROKEAHA.112.659656 pmid: 22933588
[31]   Yousef H, Czupalla C J, Lee D, et al. Aged blood impairs hippocampal neural precursor activity and activates microglia via brain endothelial cell VCAM1. Nature Medicine, 2019, 25(6): 988-1000.
doi: 10.1038/s41591-019-0440-4 pmid: 31086348
[32]   Li Z L, Korhonen E A, Merlini A, et al. Angiopoietin-2 blockade ameliorates autoimmune neuroinflammation by inhibiting leukocyte recruitment into the CNS. The Journal of Clinical Investigation, 2020, 130(4): 1977-1990.
doi: 10.1172/JCI130308
[33]   Jiang X Y, Andjelkovic A V, Zhu L, et al. Blood-brain barrier dysfunction and recovery after ischemic stroke. Progress in Neurobiology, 2018, 163-164: 144-171.
doi: S0301-0082(16)30173-3 pmid: 28987927
[34]   Sweeney M D, Sagare A P, Zlokovic B V. Blood-brain barrier breakdown in Alzheimer disease and other neurodegenerative disorders. Nature Reviews Neurology, 2018, 14(3): 133-150.
doi: 10.1038/nrneurol.2017.188 pmid: 29377008
[35]   Niu J Q, Tsai H H, Hoi K K, et al. Aberrant oligodendroglial-vascular interactions disrupt the blood-brain barrier, triggering CNS inflammation. Nature Neuroscience, 2019, 22(5): 709-718.
doi: 10.1038/s41593-019-0369-4 pmid: 30988524
[36]   Rüber T, David B, Lüchters G, et al. Evidence for peri-ictal blood-brain barrier dysfunction in patients with epilepsy. Brain, 2018, 141(10): 2952-2965.
doi: 10.1093/brain/awy242 pmid: 30239618
[37]   Gasche Y, Fujimura M, Morita-Fujimura Y, et al. Early appearance of activated matrix metalloproteinase-9 after focal cerebral ischemia in mice: a possible role in blood-brain barrier dysfunction. Journal of Cerebral Blood Flow and Metabolism: Official Journal of the International Society of Cerebral Blood Flow and Metabolism, 1999, 19(9): 1020-1028.
doi: 10.1097/00004647-199909000-00010
[38]   Lucivero V, Prontera M, Mezzapesa D M, et al. Different roles of matrix metalloproteinases-2 and-9 after human ischaemic stroke. Neurological Sciences, 2007, 28(4): 165-170.
pmid: 17690845
[39]   Rosell A, Cuadrado E, Ortega-Aznar A, et al. MMP-9-positive neutrophil infiltration is associated to blood-brain barrier breakdown and basal lamina type IV collagen degradation during hemorrhagic transformation after human ischemic stroke. Stroke, 2008, 39(4): 1121-1126.
doi: 10.1161/STROKEAHA.107.500868 pmid: 18323498
[40]   Mehrabadi A R, Korolainen M A, Odero G, et al. Poly(ADP-ribose) polymerase-1 regulates microglia mediated decrease of endothelial tight junction integrity. Neurochemistry International, 2017, 108: 266-271.
doi: S0197-0186(17)30192-4 pmid: 28461173
[41]   Daniel Lee C Y, Daggett A, Gu X F, et al. Elevated TREM2 gene dosage reprograms microglia responsivity and ameliorates pathological phenotypes in Alzheimer’s disease models. Neuron, 2018, 97(5): 1032-1048.e5.
doi: S0896-6273(18)30101-6 pmid: 29518357
[1] NING Hui-min, ZHANGYi-zhe, HAN Yu-ying, ZHANG Chong, SONG Xiao-peng, LIANG Shuang, YANG Xiao, WANG Jun . Deletion of Prmt5 in Cerebral Endothelial Cells Leads to Cerebrovascular Disease and Astrocyte Activation[J]. China Biotechnology, 2022, 42(4): 1-8.
[2] Li-li JIANG,Jun-song ZHENG,Yan LI,Jun DENG,Li-chao FANG,Hui HUANG. Construction of Blood-brain Barrier in vitro Model Based on Microfluidic Chip[J]. China Biotechnology, 2017, 37(12): 1-7.
[3] . Studies of the Expression and Biologic Activity of an Anti- transferrin Receptor ScFv-BDNF Fusion Protein[J]. China Biotechnology, 2006, 26(03): 1-5.